1. Home /
  2. Publicaciones de patentes /
  3. BETA-GALACTOSIDASA Y USOS DE LA MISMA
BETA-GALACTOSIDASA Y USOS DE LA MISMA

Patente nacional por "BETA-GALACTOSIDASA Y USOS DE LA MISMA"

Este registro ha sido solicitado por

Persona física

a través del representante

YAHEL CONTRERAS PÉREZ

Contacto
 
 
 




  • Estado: Vigente
  • País:
  • España 
  • Fecha solicitud:
  • 05/11/2020 
  • Número solicitud:
  • P202031111 

  • Número publicación:
  • ES2909902 

  • Fecha de concesión:
  • 20/09/2023 

  • Inventores:
  • Persona física 

  • Datos del titular:
  • Persona física 
  • Datos del representante:
  • Yahel Contreras Pérez
     
  • Clasificación Internacional de Patentes:
  • C12N 9/38,C12N 15/56,A23C 9/12,C12P 19/14 
  • Clasificación Internacional de Patentes de la publicación:
  • C12N 9/38,C12N 15/56,A23C 9/12,C12P 19/14 
  • Fecha de vencimiento:
  •  
Quiero registrar una patente
registro
Reivindicaciones:
+ ES-2909902_B21. Enzima que tiene actividad beta-galactosidasa, que se selecciona de (a) una secuencia de aminoácidos que consiste en la secuencia SEC ID NO: 1; y (b) una secuencia de aminoácidos codificada por la secuencia de nucleótidos SEC ID NO: 2, en donde la enzima es capaz de hidrolizar lactosa y producir galactooligosacáridos simultáneamente a una temperatura comprendida entre 3 y 10 °C o entre 55 y 89 °C. 2. Enzima según cualquiera de la reivindicación 1, que consiste en la secuencia SEC ID NO: 1. 3. Enzima según cualquiera de las reivindicaciones 1-2, que se encuentra inmovilizada en un soporte, en particular en un material de fase sólida. 4. Secuencia nucleotídica recombinante que comprende una secuencia nucleotídica codificante de la enzima según se define en cualquiera de las reivindicaciones 1-2, unida operativamente a un promotor de expresión. 5. Construcción de expresión que comprende la secuencia nucleotídica de la reivindicación 4. 6. Célula hospedadora recombinante transformada con el ácido nucleico de la reivindicación 4 o la construcción de expresión de la reivindicación 5. 7. Procedimiento de producción de galactooligosacáridos, el procedimiento comprendiendo la etapa de incubación de la enzima según se define en cualquiera de las reivindicaciones 1-3 o de la célula hospedadora recombinante de la reivindicación 6, con un producto a base de lactosa, a un pH entre 6.5 y 8, y a una temperatura comprendida entre 3 y 10°C, o entre 55-89 °C, en donde el producto a base de lactosa, o producto lácteo, se selecciona de entre lactosa comercial, leche entera, leche semidesnatada, leche desnatada, suero de leche, leche desnatada enriquecida en grasa y suero de leche filtrado. 8. Procedimiento para aumentar el contenido de galactooligosacáridos en un producto a base de lactosa, el procedimiento comprendiendo la etapa de incubación de la enzima se define en cualquiera de las reivindicaciones 1-3 o de la célula hospedadora ecombinante de la reivindicación 6, con el producto a base de lactosa, a un pH entre 6.5 y 8, y a una temperatura comprendida entre 3 y 10°C, o entre 55-89 °C, en donde el producto a base de lactosa, o producto lácteo, se selecciona de entre lactosa comercial, leche entera, leche semidesnatada, leche desnatada, suero de leche, leche desnatada enriquecida en grasa y suero de leche filtrado. 9. Procedimiento de hidrólisis de lactosa, el procedimiento comprendiendo la etapa de incubación, en un medio líquido, de la enzima según se define en cualquiera de las reivindicaciones 1-3 o de la célula hospedadora recombinante de la reivindicación 6, con un producto a base de lactosa, a un pH entre 6.5 y 8 y a una temperatura comprendida entre 3 y 10°C, o entre 55-89 °C, en donde el producto a base de lactosa, o producto lácteo, se selecciona de entre lactosa comercial, leche entera, leche semidesnatada, leche desnatada, suero de leche, leche desnatada enriquecida en grasa y suero de leche filtrado. 10. Procedimiento para reducir el contenido de lactosa en un producto lácteo, el procedimiento comprendiendo la etapa de incubación de la enzima según se define en cualquiera de las reivindicaciones 1-3 o de la célula hospedadora recombinante de la reivindicación 6, con el producto a base de lactosa, a un pH entre 6.5 y 8 y a una temperatura comprendida entre 3 y 10°C, o entre 55-89 °C, en donde el producto a base de lactosa, o producto lácteo, se selecciona de entre lactosa comercial, leche entera, leche semidesnatada, leche desnatada, suero de leche, leche desnatada enriquecida en grasa y suero de leche filtrado. 11. Procedimiento según cualquiera de las reivindicaciones 7-10, en donde la etapa de incubación se lleva a cabo a una temperatura entre 55 y 89°C y el procedimiento comprende, opcionalmente, una etapa de enfriamiento anteriormente y/o posteriormente a la etapa de incubación, en donde la temperatura en la (s) etapa (s) de enfriamiento está comprendida entre 3 y 10°C. 12. Procedimiento de preparación de un producto lácteo pasteurizado que comprende pasteurizar el producto lácteo en presencia de una enzima según se define en cualquiera de las reivindicaciones 1-3 o la célula hospedadora recombinante según la reivindicación 6, a un pH entre 6.5 y 8, en donde el producto a base de lactosa, o producto lácteo, se selecciona de entre lactosa comercial, leche entera, leche emidesnatada, leche desnatada, suero de leche, leche desnatada enriquecida en grasa y suero de leche filtrado. 13. Procedimiento de la reivindicación 12, en donde la etapa de pasteurización se lleva a cabo a una temperatura entre 55 y 89°C, durante un periodo de tiempo entre 5 y 30 segundos. 14. Procedimiento según cualquiera de las reivindicaciones 12-13, en donde previamente a la etapa de pasteurización, el producto lácteo y la enzima se enfrían a una temperatura entre 3 y 10°C, particularmente entre 4 y 9°C, particularmente entre 6 y 8°C. 15. Procedimiento según cualquiera de las reivindicaciones 12-14, en donde posteriormente a la etapa de pasteurización, el producto lácteo resultante se enfría a una temperatura entre 3 y 10°C, particularmente entre 3.5 y 5°C. 16. Procedimiento según cualquiera de las reivindicaciones 12-15, donde la etapa de enfriamiento se lleva a cabo durante un periodo de tiempo de entre 10 y 48 horas, particularmente entre 15 y 30 horas. 17. Producto lácteo obtenible mediante el procedimiento definido en cualquiera de las reivindicaciones 7-16.
+ ES-2909902_A11. Enzima que tiene actividad beta-galactosidasa, dicha enzima comprendiendo una secuencia seleccionada de entre (a) una secuencia de aminoácidos con una identidad de secuencia de al menos un 85% con la secuencia SEC ID NO: 1; y (b) una secuencia de aminoácidos codificada por una secuencia de nucleótidos que tiene una identidad de secuencia de al menos un 85% con la secuencia SEC ID NO: 2. 2. Enzima según la reivindicación 1, que se selecciona de (a) una secuencia de aminoácidos que consiste en la secuencia SEC ID NO: 1; y (b) una secuencia de aminoácidos codificada por la secuencia de nucleótidos SEC ID NO: 2. 3. Enzima según cualquiera de las reivindicaciones 1-2, que consiste en la secuencia SEC ID NO: 1. 4. Enzima según cualquiera de las reivindicaciones 1-3, que se encuentra inmovilizada en un soporte, en particular en un material de fase sólida. 5. Secuencia nucleotídica recombinante que comprende una secuencia nucleotídica codificante de la enzima según se define en cualquiera de las reivindicaciones 1-3, unida operativamente a un promotor de expresión. 6. Construcción de expresión que comprende la secuencia nucleotídica de la reivindicación 5. 7. Célula hospedadora recombinante transformada con el ácido nucleico de la reivindicación 5 o la construcción de expresión de la reivindicación 6. 8. Producto lácteo que comprende la enzima según cualquiera de las reivindicaciones 1-4, la secuencia nucleotídica recombinante según la reivindicación 5, construcción de expresión de la reivindicación 6 o la célula hospedadora recombinante según la reivindicación 7. 9. Producto lácteo según la reivindicación 8, en donde la enzima está inactivada. 10. Uso de la enzima según se define en cualquiera de las reivindicaciones 1-4, de la secuencia nucleotídica recombinante de la reivindicación 5, de la construcción de expresión de la reivindicación 6, o de la célula hospedadora recombinante según la reivindicación 7, para la producción de galactooligosacáridos a partir de lactosa. 11. Uso de la enzima según se define en cualquiera de las reivindicaciones 1-4, de la secuencia nucleotídica recombinante de la reivindicación 5, de la construcción de expresión de la reivindicación 6 o de la célula hospedadora recombinante según la reivindicación 7, para aumentar el contenido de galactooligosacáridos en un producto lácteo. 12. Uso de la enzima según se define en cualquiera de las reivindicaciones 1-4, de la secuencia nucleotídica recombinante de la reivindicación 5, de la construcción de expresión de la reivindicación 6 o de la célula hospedadora recombinante según la reivindicación 7, para la hidrólisis de lactosa. 13. Uso de la enzima según se define en cualquiera de las reivindicaciones 1-4, de la secuencia nucleotídica recombinante de la reivindicación 5, de la construcción de expresión de la reivindicación 6 o de la célula hospedadora recombinante según la reivindicación 7, para reducir el contenido de lactosa en un producto lácteo. 14. Procedimiento de producción de galactooligosacáridos, el procedimiento comprendiendo la etapa de incubación de la enzima según se define en cualquiera de las reivindicaciones 1-4 o de la célula hospedadora recombinante de la reivindicación 7, con un producto a base de lactosa, a un pH entre 6.5 y 8, y a una temperatura comprendida entre 3 y 10°C, o entre 55-89 °C 15. Procedimiento para aumentar el contenido de galactooligosacáridos en un producto a base de lactosa, el procedimiento comprendiendo la etapa de incubación de la enzima se define en cualquiera de las reivindicaciones 1-4 o de la célula hospedadora recombinante de la reivindicación 7, con el producto a base de lactosa, a un pH entre 6.5 y 8, y a una temperatura comprendida entre 3 y 10°C, o entre 55-89 °C 16. Procedimiento de hidrólisis de lactosa, el procedimiento comprendiendo la etapa de incubación, en un medio líquido, de la enzima según se define en cualquiera de las reivindicaciones 1-4 o de la célula hospedadora recombinante de la reivindicación 7, con n producto a base de lactosa, a un pH entre 6.5 y 8 y a una temperatura comprendida entre 3 y 10°C, o entre 55-89 °C. 17. Procedimiento para reducir el contenido de lactosa en un producto lácteo, el procedimiento comprendiendo la etapa de incubación de la enzima según se define en cualquiera de las reivindicaciones 1-4 o de la célula hospedadora recombinante de la reivindicación 7, con el producto a base de lactosa, a un pH entre 6.5 y 8 y a una temperatura comprendida entre 3 y 10°C, o entre 55-89 °C 18. Procedimiento según cualquiera de las reivindicaciones 14-17, en donde la etapa de incubación se lleva a cabo a una temperatura entre 55 y 89°C y el procedimiento comprende, opcionalmente, una etapa de enfriamiento anteriormente y/o posteriormente a la etapa de incubación, en donde la temperatura en la (s) etapa (s) de enfriamiento está comprendida entre 3 y 10°C. 19. Procedimiento de preparación de un producto lácteo pasteurizado que comprende pasteurizar el producto lácteo en presencia de una enzima según se define en cualquiera de las reivindicaciones 1-4 o la célula hospedadora recombinante según la reivindicación 7, a un pH entre 6.5 y 8. 20. Procedimiento de la reivindicación 19, en donde la etapa de pasteurización se lleva a cabo a una temperatura entre 55 y 89°C, durante un periodo de tiempo entre 5 y 30 segundos. 21. Procedimiento según cualquiera de las reivindicaciones 19-20, en donde previamente a la etapa de pasteurización, el producto lácteo y la enzima se enfrían a una temperatura entre 3 y 10°C, particularmente entre 4 y 9°C, particularmente entre 6 y 8°C. 22. Procedimiento según cualquiera de las reivindicaciones 19-21, en donde posteriormente a la etapa de pasteurización, el producto lácteo resultante se enfría a una temperatura entre 3 y 10°C, particularmente entre 3.5 y 5°C. 23. Procedimiento según cualquiera de las reivindicaciones 19-22, donde la etapa de enfriamiento se lleva a cabo durante un periodo de tiempo de entre 10 y 48 horas, particularmente entre 15 y 30 horas.

Los productos y servicios protegidos por este registro son:
C12N 9/38 - C12N 15/56 - A23C 9/12 - C12P 19/14

Descripciones:
+ ES-2909902_B2 P-galactosidasa y usos de la misma La presente invención está relacionada con los campos de la enzimología y la industria agroalimentaria. En particular, la presente invención se refiere a una nueva enzima pgalactosidasa y a su uso en la hidrólisis de lactosa, así como en la producción de galactooligosacáridos (GOS) a partir de lactosa. Las propiedades únicas de la enzima de la invención la hace especialmente útil para llevar a cabo la producción de GOS tanto en condiciones de pasteurización como a baja temperatura, lo cual supone una ventaja industrial importante respecto a otras enzimas. ESTADO DE LA TÉCNICA La p-galactosidasa (EC 3.2.1.23) , también llamada lactasa, tiene como función primaria la hidrólisis de la lactosa en D-galactosa y D-glucosa. Por ello, la aplicación fundamental de las p-galactosidasas se circunscribe al ámbito de los productos y subproductos lácteos. Además, esta enzima posee actividad transgalactosilasa y se utiliza para la síntesis de galactosil-oligosacáridos, compuestos con un interés creciente en el área agroalimentaria y farmacéutica. Como alternativa no enzimática a la hidrólisis con p-galactosidasas se puede utilizar la hidrólisis química, pero produce efectos no deseables (p. ej.: pérdida de nutrientes, defectos organolépticos, etc.) Las p-galactosidasas se emplean en la industria agroalimentaria para reducir el contenido en lactosa de productos lácteos y derivados, lo que tiene un interés muy variado. Industrialmente, dos tipos de p-galactosidasas son de creciente importancia en los procesos: las termoestables y las resistentes al frío. El empleo de enzimas termoestables a altas temperaturas está relacionado a la disminución de la viscosidad del sustrato y a la reducción de la posibilidad de contaminación microbiana. Las enzimas activas en el frío posibilitan su aplicación en el tratamiento de la leche y de los productos lácteos bajo condiciones que permiten preservar el sabor y las características nutricionales de esos alimentos. La producción de derivados lácteos con niveles reducidos de lactosa se atribuye a tres principales ventajas: (a) la obtención de productos para los grupos de población con intolerancia a la lactosa; (b) formación de los galatooligosacáridos (GOS) , que favorecen el crecimiento de la microflora intestinal; y (c) mejora en las características tecnológicas de los productos lácteos. La hidrólisis de la lactosa con la p-galactosidasa tiene su mayor foco en el desarrollo de leche y derivados lácteos que estén exentos o con contenidos reducidos de ese azúcar, posibilitando su consumo por individuos intolerantes a la lactosa. Por otro lado, la alta concentración de la lactosa en productos lácteos no fermentados, como por ejemplo en helado y leche condensada, puede llevar a la cristalización excesiva de la lactosa, resultando en productos con textura arenosa o áspera. De esta forma, la hidrólisis mejora la capacidad de absorción y cremosidad, y estos productos se tornan más digeribles. Otra perspectiva de la utilización de esta enzima es la producción de galactooligosacáridos, carbohidratos considerados prebióticos y que presentan propiedades tecnológicas y nutricionales reconocidas. Entre las ventajas asociadas a la síntesis de estos carbohidratos a partir de la lactosa está la reducción en el contenido calórico del alimento, la reducción de la intolerancia a la lactosa y otros tres importantes efectos provenientes de la sinergia entre los GOS y los probióticos, es decir, en la modulación del sistema inmune, el tránsito intestinal y el estímulo a la asimilación de nutrientes. A pesar de los esfuerzos realizados hasta la fecha, existe todavía la necesidad de enzimas p-galactosidasas termoestables con una actividad mejorada. EXPLICACIÓN DE LA INVENCIÓN Los presentes inventores han encontrado una nueva enzima beta-galactosidasa (BWßg1) que muestra ser estable y eficiente en la producción de GOS a temperaturas elevadas, compatibles con los tratamientos de esterilización de productos lácteos, disminuyendo significativamente el riesgo de contaminación por crecimiento microbiano adventicio. Los datos proporcionados más abajo también muestran que la enzima de la invención tiene una alta afinidad por su sustrato natural, la lactosa. Y, por otro lado, que la enzima de la invención es altamente eficiente en la producción de GOS, produciendo cantidades significativas de galactooligosacáridos en un corto periodo de tiempo. Además, es versátil en cuanto a la naturaleza del sustrato, ya que partiendo de lactosa o leche se alcanzan rendimientos altos. Por lo que la enzima de la invención ejerce un doble papel: hidroliza la lactosa y, a la vez, sintetiza GOS. Ambas actividades, además, a bajas y altas temperaturas. La buena capacidad catalítica de la beta-galactosidasa de la invención, por lo tanto, tiene un impacto sorprendente en las propiedades finales del producto ya que la enzima es capaz de degradar la lactosa, que puede tener un efecto perjudicial, e incorporar GOS, con un efecto beneficioso, al producto. Por lo tanto, la enzima de la invención permite obtener productos con propiedades beneficiosas para la salud. En relación con lo anterior, es remarcable que esa doble función es exhibida por la enzima en las mismas condiciones de temperatura y pH, es decir que en una sola etapa de incubación de la enzima con el sustrato, se consigue la reducción en el contenido de lactosa y la producción de GOS. Sorprendentemente, las condiciones de temperatura y pH óptimas hacen que la enzima de la invención se pueda usar en un proceso de pasteurización. Tal y como se muestra más abajo, los investigadores llevaron a cabo la pasteurización de un producto lácteo en presencia de la enzima de la invención y de dos enzimas comerciales: únicamente en el caso de la enzima de la invención, se consiguió simultáneamente una producción notable de GOS y una reducción significativa de la lactosa. Lo anterior supone una mejora sustancial en el sector agroalimentario, en particular de productos lácteos, ya que la enzima de la invención permite llevar a cabo en una única etapa a condiciones de temperatura, tiempo y pH: la hidrólisis de lactosa, la producción de GOS y la destrucción de microorganismos. Sorprendentemente, los inventores han encontrado, además, que esta enzima es altamente activa a temperaturas bajas, entre 3 y 10°C. Ventajosamente, trabajando a estas temperaturas se previene el crecimiento de microorganismos. Es la primera vez que se reporta una enzima beta-galactosidasa con semejante perfil de actividad en condiciones de temperatura tan diferentes, haciendo de esta enzima una herramienta altamente versátil. La versatilidad, así como la alta eficacia en síntesis de GOS e hidrólisis de lactosa hacen de la enzima de la invención una herramienta muy atractiva en el sector agroalimentario, en particular de los productos lácteos. Así, en un primer aspecto la presente invención proporciona una enzima que tiene actividad p-galactosidasa, que se selecciona de (a) una secuencia de aminoácidos que consiste en la secuencia SEC ID NO: 1; y (b) una secuencia de aminoácidos codificada por la secuencia de nucleótidos SEC ID NO: 2, en donde la enzima es capaz de hidrolizar lactosa y producir galactooligosacáridos simultáneamente a una temperatura comprendida entre 3 y 10 °C o entre 55 y 89 °C. En una realización, la enzima tiene una identidad de secuencia aminoacídica de al menos un 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 o es 100% con la secuencia SEC ID NO: 1. En una realización, la enzima tiene una identidad de secuencia del 100% con la secuencia SEC ID NO: 1. En una realización, la enzima tiene una identidad de secuencia nucleotídica de al menos un 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 o es 100% con la secuencia SEC ID NO: 2. En una realización, la enzima tiene una identidad de secuencia del 100% con la secuencia SEC ID NO: 2. En la presente invención, el término "identidad" se refiere al porcentaje de residuos que son idénticos en las dos secuencias cuando las secuencias se alinean óptimamente. Si, en el alineamiento óptimo, una posición en una primera secuencia está ocupada por el mismo residuo que la posición correspondiente en la segunda secuencia, las secuencias presentan identidad con respecto a esa posición. El nivel de identidad entre dos secuencias (o "porcentaje de identidad de secuencia") se mide como una relación del número de posiciones idénticas compartidas por las secuencias con respecto al tamaño e las secuencias (es decir, porcentaje de identidad de secuencia = (número de posiciones idénticas / número total de posiciones) x 100) . Se conocen varios algoritmos matemáticos para obtener rápidamente el alineamiento óptimo y calcular la identidad entre dos o más secuencias y se incorporan en varios programas de software disponibles. Ejemplos de dichos programas incluyen los programas MATCH-BOX, MULTAIN, GCG, FASTA y ROBUST, entre otros, para el análisis de secuencias. Los programas de análisis de software preferidos incluyen los programas ALIGN, CLUSTAL W y BLAST (por ejemplo, BLAST 2.1, BL2SEQ y versiones posteriores de los mismos) . Para el análisis de secuencias de aminoácidos, se usan matrices de pesos, tales como las matrices BLOSUM (por ejemplo, las matrices BLOSUM45, BLOSUM50, BLOSUM62 y BLOSUM80) , matrices Gonnet o matrices PAM (por ejemplo, las matrices PAM30, PAM70, PAM120, PAM160, PAM250 y PAM350) , con el fin de determinar la identidad. Los programas BLAST proporcionan el análisis de al menos dos secuencias de aminoácidos, ya sea alineando una secuencia seleccionada contra múltiples secuencias en una base de datos (por ejemplo, GenSeq) , o, con BL2SEQ, entre dos secuencias seleccionadas. Los programas BLAST se modifican preferentemente con programas de filtrado de baja complejidad tales como los programas DUST o SEG, que preferentemente se integran en las operaciones del programa BLAST. Si se usan costes por existencia de huecos (o puntuaciones por hueco) , el coste por existencia de huecos se establece preferentemente entre aproximadamente -5 y -15. Se pueden usar parámetros por hueco similares con otros programas según convenga. Los programas BLAST y los principios que los subyacen se describen adicionalmente en, por ejemplo, Altschul et al., "Basic local alignment search tool", 1990, J. Mol. Biol, v. 215, páginas 403-410. Para el análisis de múltiples secuencias, se puede usar el programa CLUSTAL W. El programa CLUSTAL W se ejecuta deseablemente usando parámetros "dinámicos" (frente a "rápidos") . Las secuencias de aminoácidos se evalúan usando un conjunto variable de matrices BLOSUM dependiendo del nivel de identidad entre las secuencias. El programa CLUSTAL W y los principios de operación subyacentes se describen adicionalmente en, por ejemplo, Higgins et al., "CLUSTAL V: improved software for multiple sequence alignment", 1992, CABIOS, 8 (2) , páginas 189-191. En una realización del primer aspecto de la invención, la enzima tiene actividad en un rango de pH entre 6 y 9, y en un rango de temperatura entre 3 y 10°C y/o entre 60 y 89°C. En otra realización del primer aspecto de la invención, la enzima tiene actividad a un pH entre 6.5 y 8 y un rango de temperatura entre 4 y 9°C y/o entre 75 y 85°C. Para los fines de la presente invención, cualquier intervalo dado incluye los valores de los extremos inferior y superior del intervalo. En un segundo aspecto, la presente invención proporciona una secuencia nucleotídica recombinante que comprende una secuencia nucleotídica que codifica la enzima de la invención, unida operativamente a un promotor de expresión. En una realización, la secuencia nucleotídica recombinante comprende una secuencia nucleotídica que codifica una secuencia que tiene una identidad de al menos un 85% con la secuencia SEC ID NO: 2. En otra realización del segundo aspecto de la invención la secuencia nucleotídica codifica para una secuencia que tiene una identidad de al menos un 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 o es 100% con la secuencia SEC ID NO: 2. En otra realización del segundo aspecto de la invención, la secuencia nucleotídica que codifica la enzima se corresponde con la secuencia SEQ ID NO: 2. Ejemplos ilustrativos y no limitativos de promotores de expresión son los promotores de: LTR, SV40, lac o trp de E. coli, PL del fago lambda y otros conocidos por controlar la expresión de genes en células eucariotas, procariotas o virus. En un tercer aspecto la presente invención proporciona una construcción de expresión que comprende la secuencia nucleotídica recombinante del segundo aspecto de la invención. Las construcciones comprenden un vector, tal como un plásmido, en el que se inserta la secuencia de la enzima en una orientación directa o inversa. En una realización del tercer aspecto, la construcción génica es un vector de expresión. Ejemplos ilustrativos y no limitativos de vectores comerciales son: pQE70, pQE60, pQE-9 (Qiagen) , pD10, psiX174, pBluescript II KS; pNH8A, pNH16a, pNH18A, pNH46A (Stratagene) ; ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia) ; Eukar y otic: pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, MSG, pSVL (Pharmacia) . Los vectores incluyen secuencias de ADN cromosómicas, no cromosómicas y sintéticas, por ejemplo, derivados de SV40; plásmidos bacterianos; ADN de fago; baculovirus; plásmidos de levadura; vectores derivados de combinaciones de plásmidos y ADN de fagos, ADN viral como vaccinia, adenovirus, virus de la viruela aviar y pseudorrabia. Sin embargo, puede usarse cualquier otro vector siempre que sea replicable y viable en el hospedador. El vector de expresión también proporciona un sitio de unión al ribosoma para el inicio de la traducción y un terminador de la transcripción. El vector también puede incluir secuencias apropiadas para amplificar la expresión. Además, los vectores de expresión pueden contener uno o más genes marcadores seleccionables para proporcionar un rasgo fenotípico para la selección de células hospedadoras transformadas tales como dihidrofolato reductasa o resistencia a neomicina para cultivo de células eucarióticas, o tal como resistencia a tetraciclina o ampicilina en E. coli. La inserción del gen de la presente invención en un vector, la inserción del gen marcador de selección (si es necesario) y la inserción de un promotor (si es necesario) , y similares, pueden llevarse a cabo mediante una tecnología de ADN de recombinación estándar. En un cuarto aspecto la presente invención proporciona una célula hospedadora recombinante transformada con el ácido nucleico recombinante del segundo aspecto de la invención o la construcción del tercer aspecto de la invención. Ejemplos ilustrativos y no limitativos de células hospedadoras adecuadas son: células bacterianas, como Escheríchia coli, Streptomyces, Bacillus subtilis; fúngicas como la levadura; células de insecto como la Dmsophila S2 y Spodoptera Sf9; de animal tal como CHO, COS o de melanoma de Bowes; adenovirus; células vegetales, etc. la selección de un hospedador adecuado forma parte del conocimiento del experto en la materia. La célula hospedadora transformada se puede obtener por transfección o transformación, usando el vector de la presente invención mencionado anteriormente. La transfección y transformación se pueden llevar a cabo, por ejemplo, mediante un método de coprecipitación de fosfato cálcico, electroporación, lipofección, microinyección, un método de Hanahan, un método de acetato de litio, método de protoplasto - polietilenglicol, y similares. Otro aspecto de la invención es proporcionar un método para producir una pgalactosidasa. En una realización del método de producción de la invención, la pgalactosidasa se produce utilizando el transformante mencionado anteriormente. En el método de producción de esta realización, el transformante se cultiva en condiciones tales que se produzca la enzima codificada. Los métodos de cultivo y las condiciones de cultivo no están particularmente limitadas siempre que se pueda producir la proteína p-galactosidasa deseada. Es decir, los métodos y las condiciones de cultivo adecuadas para cultivar los microorganismos que se van a utilizar pueden ajustarse de forma apropiada a las condiciones en las que se produce la p-galactosidasa. Se puede emplear cultivo líquido o cultivo sólido como método de cultivo, en particular cultivo líquido. Como medio, se puede utilizar cualquier medio en el que puedan crecer los transformantes que se van a utilizar. Por ejemplo, un medio suplementado con una fuente de carbono como glucosa, sacarosa, gentiobiosa, almidón soluble, glicerina, dextrina, melaza y ácido orgánico; y además, una fuente de nitrógeno tal como sulfato de amonio, carbonato de amonio, fosfato de amonio, acetato de amonio o peptona, extracto de levadura, licor de maceración de maíz, hidrolizado de caseína, salvado y extracto de carne; y además, se puede usar una sal inorgánica tal como sal de potasio, sal de magnesio, sal de sodio, sal de fosfato, sal de manganeso, sal de hierro y sal de zinc, y similares. Con el fin de promover el crecimiento de los transformantes que se van a usar, se puede añadir al medio vitaminas, aminoácidos y similares. El medio se cultiva en condiciones aeróbicas de manera que el pH del medio se ajuste, por ejemplo, a aproximadamente 3 a 10 (preferiblemente aproximadamente 7 a 8) , y la temperatura de cultivo es generalmente aproximadamente 10 ° C a 50 ° C (preferiblemente aproximadamente 20 ° C a 37 ° C) durante 1 a 7 días (preferiblemente 3 a 4 días) . Un ejemplo del método de cultivo puede incluir un método de cultivo por agitación y un método de cultivo aeróbico sumergido. Una vez se transforman las células con la onstrucción génica, estas se cultivan hasta alcanzar una densidad deseada y se induce, mediante métodos rutinarios, la activación del promotor de expresión. Las células transformadas se pueden recoger por centrifugación, romper por medios químicos o físicos, y el crudo resultante someterse a purificación. La enzima se puede recuperar y purificar de los medios de cultivo de células recombinantes mediante métodos que incluyen la precipitación por sulfato de amonio o etanol, la separación por cromatografía y la ultrafiltración. Se pueden incorporar también etapas de plegamiento para completar la configuración de la proteína madura. Finalmente, la purificación se puede llevar a cabo por cromatografía líquida de alta resolución (HPLC) . La p-galactosidasa de la presente invención se proporciona en forma de, por ejemplo, una preparación enzimática. La preparación enzimática puede contener, además de un ingrediente activo (p-galactosidasa de la presente invención) , excipiente, agentes tampón, agentes de suspensión, estabilizador, conservantes, antisépticos, solución salina fisiológica y similares. Los ejemplos del excipiente pueden incluir lactosa, sorbitol, D-manitol, sacarosa y similares. Los ejemplos del agente tampón pueden incluir fosfato, citrato, acetato y similares. Los ejemplos del estabilizador pueden incluir propilenglicol y ácido ascórbico y similares. Los ejemplos del conservante pueden incluir fenol, cloruro de benzalconio, alcohol bencílico, clorobutanol, metil parabeno y similares. Alternativamente, la enzima se puede inmovilizar sobre un material en fase sólida adecuado tal como un material de intercambio iónico, tal como DEAE-celulosa o material similar, para proporcionar productos de composición enzimática inmovilizada. Alternativamente, la enzima, opcionalmente en combinación con excipiente, agentes tampón, agentes de suspensión, estabilizador, conservantes, antisépticos, solución salina fisiológica y similares, se puede congelar o liofilizar. Ventajosamente, gracias al perfil de termoestabilidad mostrado por la enzima de la invención, el material resultante puede almacenarse o transportarse al laboratorio o entorno en el que se vaya a llevar a cabo posteriormente la reacción. El material liofilizado proporciona una forma más conveniente de almacenamiento y transporte, ya que no se requiere refrigeración. En un quinto aspecto, la presente invención proporciona un producto lácteo que comprende la enzima según se ha definido en el primer aspecto, la secuencia nucleotídica recombinante según el segundo aspecto, la construcción de expresión según el tercer aspecto o la célula hospedadora recombinante según el cuarto aspecto. En una realización, el producto lácteo comprende la enzima inactivada. Esta realización se corresponderá al producto final, una vez llevado a cabo el proceso de hidrólisis de lactosa/producción de GOS y se ha llevado a cabo la inactivación de la enzima mediante cualquiera de los protocolos rutinarios. En el contexto de la presente invención, el término "enzima inactivada" significa que la enzima se ha desnaturalizado, modificado o degradado y ha perdido su actividad betagalactosidasa. De la caracterización que se incorpora más abajo, los GOS producidos por la enzima de la invención, de 3 y 4 unidades, se han reportado en el estado de la técnica por ejercer un papel beneficioso en la salud. Por lo tanto, la enzima, secuencia recombinante, construcción de expresión o célula hospedadora descrita anteriormente puede usarse para producir una mezcla de galactooligosacáridos que puede formar parte de un producto para mejorar la salud intestinal. Dicho producto puede seleccionarse del grupo que consiste en productos lácteos (por ejemplo leche líquida, leche en polvo seca tal como la leche entera en polvo, leche desnatada en polvo, leche desnatada enriquecida en grasa en polvo, suero de leche en polvo, leches infantiles, leche maternizada, helados, yogur, queso, productos de leche fermentada) , bebidas tales como el zumo de fruta, los alimentos infantiles, cereales, pan, galletas, dulces, pasteles, suplementos alimenticios, suplementos dietéticos, alimentos para animales, alimentos para aves o por supuesto cualquier otro alimento o bebida. La presencia de galacto-oligosacáridos en dichos productos tiene la ventaja de incrementar el crecimiento de las Bifidobacterium promotoras de la salud en el producto o en la flora intestinal del consumidor después de la ingesta del producto o en ambos. En un sexto aspecto, la invención proporciona el uso de la enzima, de la secuencia nucleotídica recombinante, de la construcción de expresión o de la célula hospedadora recombinante de la invención, para la producción de galactooligosacáridos a partir de lactosa. En otro aspecto, la invención proporciona el uso de la enzima, de la secuencia nucleotídica recombinante, de la construcción de expresión o de la célula hospedadora recombinante de la invención, para incrementar la cantidad de GOS en un producto a base de lactosa. En un séptimo aspecto, la invención proporciona un procedimiento de producción de galactooligosacáridos que comprende la etapa de incubación de la enzima o célula hospedadora transformada según se definen más arriba con un producto a base de lactosa a un pH entre 6.5 y 8.0. En una realización, esta etapa de incubación se lleva a cabo a una temperatura comprendida entre 55 y 89°C o entre 65 y 85°C o entre 70 y 75°C, y a un pH entre 6.5 y 8. El tiempo de la etapa de incubación será el necesario para alcanzar la cantidad de GOS deseada y dependerá, entre otros factores, de la naturaleza del sustrato. El experto en la materia puede parar la incubación en cualquier momento inactivando la enzima, por ejemplo subiendo la temperatura por encima de 90°C, por ejemplo entre 90-100°C.En otra realización, previamente y/o posteriormente a la etapa de incubación a alta temperatura, el procedimiento comprende el enfriamiento del medio de reacción (que incluye el producto a base de lactosa y la enzima) a una temperatura entre 3 y 10°C, en particular entre 5 y 9°C, en particular 8°C durante un periodo de tiempo de entre 10 y 48 horas, particularmente entre 15 y 30 horas, a un pH entre 6.5 y 8. Alternativamente, en otra realización, la etapa de incubación se lleva a cabo a una temperatura comprendida entre 3 y 10°C, entre 5 y 9°C, o a 8°C. En otro aspecto, la invención proporciona un procedimiento para aumentar el contenido en galactooligosacáridos en un producto lácteo, que comprende la etapa de incubación de la enzima o célula hospedadora transformada según se definen más arriba con un producto a base de lactosa a un pH entre 6.5 y 8.0. En una realización, la incubación se lleva a cabo a una temperatura comprendida entre 55 y 89°C o entre 65 y 85°C o entre 70 y 75°C, a un pH entre 6.5 y 8. El tiempo de la etapa de incubación será el necesario para alcanzar la cantidad de GOS deseada y dependerá, entre otros factores, de la naturaleza del sustrato. El experto en la materia puede parar la incubación en cualquier momento inactivando la enzima, por ejemplo subiendo la temperatura por encima de 90°C, por ejemplo entre 90-100°C. En otra realización, previamente y/o posteriormente a la etapa de incubación a alta temperatura, el procedimiento comprende el enfriamiento del medio de reacción (que incluye el producto a base de lactosa y la enzima) a una temperatura entre 3 y 10°C, en particular entre 5 y 9°C, en particular 8°C, a un pH entre 6.5 y 8, durante un periodo de tiempo de entre 10 y 48 horas, particularmente entre 15 30 horas. Alternativamente, en otra realización, la etapa de incubación se lleva a cabo a una temperatura comprendida entre 3 y 10°C, entre 5 y 9°C, o a 8°C. En la presente invención, "producto a base de lactosa" tiene el mismo significado que "sustrato que contiene lactosa" y "producto lácteo" y se refiere a cualquier producto, natural o sintético, que incorpora en su composición lactosa o, alternativamente, consiste en lactosa. El producto a base de lactosa se puede seleccionar de entre lactosa comercial, leche entera, leche semidesnatada, leche desnatada, suero de leche, leche desnatada enriquecida en grasa y suero de leche filtrado. Estos productos lácteos pueden obtenerse de vacas, búfalas, ovejas, camellas, llamas o cabras. La leche desnatada enriquecida en grasa se define como la leche entera que ha sido desnatada para eliminar la grasa de la leche, la cual se reemplaza posteriormente añadiendo aceite o grasa vegetal. En un octavo aspecto, la presente invención proporciona el uso de la enzima, de la secuencia nucleotídica recombinante, de la construcción de expresión o de la célula hospedadora recombinante de la invención, según se han definido más arriba, en la hidrólisis de lactosa. En otro aspecto, la presente invención proporciona el uso de la enzima, de la secuencia nucleotídica recombinante, de la construcción de expresión o de la célula hospedadora recombinante de la invención, según se han definido más arriba, para reducir el contenido de lactosa en un producto a base de lactosa. En un noveno aspecto, la presente invención proporciona un procedimiento de hidrólisis de lactosa que comprende la etapa de incubación de la enzima o de la célula hospedadora recombinante según se ha definido más arriba, con un producto a base de lactosa, a un pH entre 6.5 y 8.0. En una realización, la incubación se lleva a cabo a una temperatura comprendida entre 55 y 89°C o entre 65 y 85 o entre 70 y 75°C, a un pH entre 6.5 y 8. El tiempo de la etapa de incubación será el necesario para alcanzar el nivel de lactosa deseado y dependerá, entre otros factores, de la naturaleza del sustrato. El experto en la materia puede parar la incubación en cualquier momento inactivando la enzima, por ejemplo subiendo la temperatura por encima de 90°C, por ejemplo entre 90-100°C. Alternativamente, en otra realización, la etapa de incubación se lleva a cabo a una temperatura comprendida entre 3 y 10°C, entre 5 y 9°C, o a 8°C, a pH entre 6.5 y 8. En otra realización, previamente y/o posteriormente a la etapa de incubación, el rocedimiento comprende el enfriamiento del medio de reacción (que incluye el producto a base de lactosa y la enzima) a una temperatura entre 3 y 10°C, en particular entre 5 y 9°C, en particular 8°C, a un pH entre 6.5 y 8, durante un periodo de tiempo de entre 10 y 48 horas, particularmente entre 15 y 30 horas. En otro aspecto, la presente invención proporciona un procedimiento de reducción del contenido de lactosa en un producto lácteo, que comprende la etapa de incubación de la enzima o de la célula hospedadora recombinante según se ha definido más arriba, con un producto a base de lactosa, a un pH entre 6.5 y 8.0. En una realización, la incubación se lleva a cabo a una temperatura comprendida entre 55 y 89°C o entre 65 y 85 o entre 70 y 75°C, a un pH entre 6.5 y 8. El tiempo de la etapa de incubación será el necesario para alcanzar la cantidad de GOS deseada y dependerá, entre otros factores, de la naturaleza del sustrato. El experto en la materia puede parar la incubación en cualquier momento inactivando la enzima, por ejemplo subiendo la temperatura por encima de 90°C, por ejemplo entre 90-100°C.Alternativamente, en otra realización, la etapa de incubación se lleva a cabo a una temperatura comprendida entre 3 y 10°C, entre 5 y 9°C, o a 8°C, a un pH entre 6.5 y 8. En otra realización, previamente y/o posteriormente a la etapa de incubación, el procedimiento comprende el enfriamiento del medio de reacción (que incluye el producto a base de lactosa y la enzima) a una temperatura entre 3 y 10°C, en particular entre 5 y 9°C, en particular 8°C, durante un periodo de tiempo de entre 10 y 48 horas, particularmente entre 15 y 30 horas, a un pH entre 6.5 y 8. Generalmente los procedimientos y aparatos empleados para la hidrólisis de lactosa son similares a los usados comúnmente en procesos de hidrólisis enzimática equivalentes y una amplia gama de posibles sistemas y procedimientos serán evidentes para los expertos en la técnica. Por tanto, en una realización, en un modo de incubación continua, el sustrato que contiene lactosa en forma de solución se pasa a un reactor que contiene la enzima o la preparación de células enteras enzimáticamente activa, preferiblemente en forma inmovilizada. La composición de enzima inmovilizada o la preparación de células enteras inmovilizadas, y los productos de glucosa y galactosa se recuperan aguas abajo del reactor. En una realización de los procedimientos proporcionados por la presente invención, el sustrato a base de lactosa que se utiliza en la etapa de incubación es líquido. En otra realización de los procedimientos proporcionados por la presente invención, el sustrato a base de lactosa que se utiliza en la etapa de incubación es sólido. En esta realización, la enzima se puede incorporar en forma de preparación enzimática líquida o, alternativamente, añadirla en forma sólida, para, posteriormente, incorporar un medio acuoso a un pH entre 6.5 y 8.0. Además, en vista de la alta estabilidad térmica la enzima puede incorporarse directamente con productos lácteos UHT antes del tratamiento térmico y puede esterilizarse ventajosamente junto con la leche durante el tratamiento térmico. Así, en un décimo aspecto la presente invención proporciona un procedimiento de preparación de un producto lácteo esterilizado, en particular pasteurizado, que comprende pasteurizar el producto lácteo, tal como leche, en presencia de la enzima o la célula hospedadora recombinante según se han definido más arriba. En una realización del décimo aspecto, la etapa de pasteurización se lleva a cabo a una temperatura entre 55 y 90°C, durante un periodo de tiempo entre 5 y 30 segundos. En otra realización del décimo aspecto, previamente a la etapa de pasteurización, el producto lácteo, en presencia de la enzima, se enfría a una temperatura entre 3 y 10°C, particularmente entre 4 y 9°C, particularmente entre 6 y 8.5°C. En otra realización del décimo aspecto, posteriormente a la etapa de pasteurización, el producto lácteo resultante se enfría a una temperatura entre 3 y 10°C, particularmente entre 3.5 y 5°C, particularmente a 4°C. En otra realización del décimo aspecto, se lleva a cabo una etapa de enfriamiento antes (entre 3-10°C) y después de la pasteurización (entre 4-9°C) . En otra realización del décimo aspecto, la (s) etapa (s) de enfriamiento se lleva (n) a cabo durante un periodo de tiempo de entre 10 y 48 horas, particularmente entre 15 y 30 horas. En una realización de los procedimientos de la invención, estos comprenden opcionalmente una o más de las etapas de inactivación y/o eliminación de la enzima, conversión del producto resultante a polvo y empaquetado en forma líquida o en polvo. Como se ha ido explicando con anterioridad y se demuestra más abajo, el producto resultante de la acción enzimática de la beta-galactosidasa de la invención presenta un bajo contenido en lactosa y está enriquecido en GOS. Por lo tanto, en undécimo aspecto, la presente invención proporciona un producto lácteo obtenible mediante cualquiera de los procedimientos proporcionados por la presente invención. A lo largo de la descripción y las reivindicaciones la palabra "comprende" y sus variantes no pretenden excluir otras características técnicas, aditivos, componentes o pasos. Además, la palabra "comprende" incluye el caso "consiste en". Para los expertos en la materia, otros objetos, ventajas y características de la invención se desprenderán en parte de la descripción y en parte de la práctica de la invención. Los siguientes ejemplos y dibujos se proporcionan a modo de ilustración, y no se pretende que sean limitativos de la presente invención. Los signos numéricos relativos a los dibujos y colocados entre paréntesis en una reivindicación, son solamente para intentar aumentar la comprensión de la reivindicación, y no deben ser interpretados como limitantes del alcance de la protección de la reivindicación. Además, la presente invención cubre todas las posibles combinaciones de realizaciones particulares y preferidas aquí indicadas. BREVE DESCRIPCIÓN DE LOS DIBUJOS FIG. 1 representa el efecto de la temperatura (T) expresada en grados centígrados en la actividad relativa (A) de la enzima, expresado en % (actividad relativa: % de actividad respecto al máximo de actividad registrada en el ensayo) . El eje Y representa la actividad, y el eje X la temperatura. FIG. 2 representa la actividad enzimática relativa (A) , expresada en %, en función de la temperatura: a 75 °C (a) , 65 °C (b) y 55 (°C) y a diferentes tiempos (t) expresados en horas. El eje "Y" representa la actividad relativa enzimática y el eje "Y" el tiempo. FIG. 3 representa el efecto del pH en la actividad relativa (A) de la enzima, expresada en %. El eje Y representa la actividad relativa, y el eje X el pH. FIG. 4 representa la producción de GOS por la enzima de la invención (barra negra) y los preparados comerciales Biocon (barra gris) y Maxilact (barra blanca) a las 16 y 24 oras de incubación a 8°C y tras la pasteurización a tiempo cero (HTST 0 h) y 24 horas después a 4°C (HTST 24 h) . Las estrellas indican si hay diferencias significativas aplicando una t-student del resultado obtenido con la enzima BWßg1 con respecto a la p-galactosidasa de Biocon (estrella gris) o con la p-galactosidasa de Maxilact (estrella blanca) . EJEMPLOS 1. Clonaje, expresión y purificación de la 3-galactosidasa Un clon de secuencia SEC ID NO: 2, seleccionado por búsqueda funcional en una metagenoteca en plásmido construida a partir de las aguas termales de As Burgas (Ourense) , se comprobó que era capaz de hidrolizar X-Gal (5-bromo-4-cloro-indolyl-p-D-galactopiranósido) ya que dio lugar a una coloración azulada en placas sólidas de medio Luria Bertani (LB) suplementadas con 100 ^g/ml de ampicilina y 0.04 % X-Gal en N, N-dimetilformamida. La secuencia de aminoácidos deducida para dicha enzima se corresponde con la secuencia SEQ ID NO: 1. La ORF de la p-galactosidasa (BWpgl) se amplificó directamente a partir del clon positivo con los cebadores MCA141 (5'CAATTCCCCTCTAGAATGACCCTGCGTGAGTTC3' (SEC ID No: 3) ) y MCA140 (5'AGTGGTGGTGGTGGTGGTGCACCCTCATACATAGCCTCAC3' (SEC ID NO: 4) ) . Para el ligamiento en el vector pET21a se utilizó el kit NEBuilder HiFi DNA assembly (New England Biolabs, "NEB") . La construcción se usó para transformar en células de E. coli T7 Express (C2566) (NEB) mediante choque térmico, siguiendo las instrucciones del fabricante y expresar la proteína, para lo cual se indujo con 0.4 mM IPTG durante 2 horas a 37°C. A continuación, se centrifugaron las células (5000 rpm 15 min 4°C) y se resuspendieron en tampón fosfato sódico 20mM pH 7.2 con 500 mM NaCl y un cocktail inhibidor de proteasas Complete Mini EDTA-Free Protease Inhibitor Cocktail (Roche) . La lisis celular se llevó a cabo mediante sonicación en hielo con un Vibra Cell sonicator (100W, 5min 2"ON/8"OFF) , (Sonics & Materials) . El extracto crudo resultante se calentó a 70°C durante 10 minutos para desnaturalizar las proteínas de E. coli. Posteriormente, el sobrenadante obtenido tras la centrifugación (14000 rpm 20 min) se hizo pasar a través de una columna de histidinas HisTrapTM HP column (GEHealthcare) iguiendo las instrucciones del fabricante y empleando un sistema de cromatografía ÁKTA (GEHealthcare) . Brevemente, la columna se equilibró con tampón fosfato sódico 20mM pH 7.2, 500 mM NaCl y 20 mM imidazol y la elución de la proteína se llevó a cabo con tampón fosfato sódico 20mM pH 7.2, 500 mM NaCl y 500 mM imidazol. Se seleccionaron aquellas fracciones correspondientes al pico de elución de la cromatografía, realizándose posteriormente un ensayo de actividad p-galactosidasa en cada una de ellas para comprobar la presencia de la enzima. Las fracciones seleccionadas se concentraron y dializaron empleando una columna Amicon Ultra-15 30, 000 MWCO (Millipore) . La concentración de proteína purificada se cuantificó siguiendo el protocolo del kit Bio-Rad Protein Assay (Bio-Rad) , utilizando seroalbúmina bovina como estándar. Las muestras de proteína en las diferentes etapas de la purificación se cargaron en un gel de acrilamida al 10% SDS-PAGE para la determinación de su peso molecular. El NZYcolour Protein Marker II (Nzytech) fue utilizado como marcador de pesos moleculares y la visualización de las proteínas se llevó a cabo mediante tinción con azul de Coomasie. De esta manera se acabó concluyendo que la enzima con actividad betagalactosidasa tenía un peso molecular de aproximadamente 75 kDa. Análisis de la secuencia aminoacídica de la proteína La secuencia aminoacídica deducida a partir de la secuencia de nucleótidos obtenida tras la secuenciación del clon positivo se comparó con otras secuencias conocidas utilizando una herramienta de búsqueda por alineamiento local proteína-proteína (BLAST) (Altschul et al., "Basic local alignment search tool", 1990, J. Mol. Biol, v. 215, páginas 403-410) . Los motivos conservados en las secuencias se buscaron empleando la herramienta ScanProsite (de Castro et al., 2006, "ScanProsite: Detection of PROSITE signature matches and ProRule-associated functional and structural residues in proteins". Nucleic Acids Res., v. 34) . Asimismo, se llevó a cabo un alineamiento múltiple de secuencias con Clustal Omega (Sievers et al., 2011, Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol., v. 7) y el mismo programa se utilizó para construir los árboles filogenéticos con otras pgalactosidasas de familias de Glicosil Hidrolasas (GHs) conocidas. Con los tests anteriores se concluyó que la secuencia de aminoácidos de BWbg1 consistía en 664 residuos aminoacídicos y que la enzima del estudio pertenece a la familia de las GH-35. Determinación de la actividad enzimática La cuantificación de la actividad enzimática se realizó empleando el sustrato ortonitrofenil-p-D-galactopiranósido (ONPG) . Las preparaciones de proteína purificada se diluyeron en 150 L de tampón Z (100 mM Na2 HPO4 , 40 mM NaH2 PO4 , 10 mM KCl, 1.6 mM MgSO4 pH 7) . Tras incubar durante 5 minutos a 80°C, se inició la reacción con la adición de 150 L de ONPG a una concentración de 4 mg mL-1. Para parar la reacción se adicionaron 100 L de Na2CO31 M a 100 L de la mezcla de reacción. El o-nitrofenol producido en la reacción se cuantificó mediante absorbancia UV a 420 nm. En los ensayos de pH, temperatura óptima y termoestabilidad se expresó la actividad enzimática como porcentaje de actividad relativa, es decir, porcentaje de actividad respecto al máximo de actividad registrada en el test. En los ensayos de cinética de ONPG e hidrólisis de lactosa la actividad p-galactosidasa se expresó en unidades enzimáticas (U) , definidas como la cantidad de enzima capaz de liberar un ^mol de producto (o-nitrophenol) por minuto (^molmin-1) en diferentes condiciones experimentales de temperatura y pH. En todos los casos las medidas se llevaron a cabo por triplicado. Cinética de ONPG e hidrólisis de lactosa. Determinación de la afinidad por lactosa La caracterización cinética de la enzima se basó en la determinación de la actividad pgalactosidasa de la proteína purificada a diferentes concentraciones de ONPG (0-10 mM) siguiendo el protocolo descrito en la sección anterior. Las medidas se realizaron por triplicado con 0.3 ^g mL-1 de enzima. Para estimar los valores de las constantes cinéticas se llevó a cabo un ajuste de regresión no lineal por mínimos cuadrados a partir de las gráficas de Michaelis Menten, con el software Prism 6.00 para Windows (GraphPad Software Inc.) . La cinética de la hidrólisis de lactosa se llevó a cabo determinando la glucosa liberada por la enzima a diferentes concentraciones de lactosa. Para ello, la proteína purificada se diluyó en tampón Z a una concentración de 104.5 ^g/mL. La velocidad inicial se determinó por triplicado utilizando 104.5 ^g mL-1 de enzima y una concentración de lactosa de 0, 10, 20 y 80 mM. Los tiempos de reacción fueron 6-20 min a 80 °C. Finalmente, se calentaron las muestras a 96 °C durante 5 min con el fin de parar la reacción. La actividad p-galactosidasa se expresa en unidades enzimáticas (U) , definidas como la cantidad de enzima capaz de liberar 1 ^mol de producto (D-glucosa) por minuto en las condiciones experimentales (^mol min -1) . La concentración de glucosa se cuantificó empleando el kit comercial D-Glucose GOD-POD (Nzytech) . Se utilizó un ajuste de regresión no linear por mínimos cuadrados para inferir los parámetros cinéticos a partir de las gráficas de Michaelis-Menten generadas (via Prism 6) . Tabla 2. Valores cinéticos de Km y Vmáx para la hidrólisis de lactosa y ONPG. Efecto de la temperatura en la estabilidad y actividad enzimática El efecto de la temperatura se determinó cuantificando la actividad relativa (porcentaje de actividad respecto a la máxima actividad registrada) de la enzima a 55-90°C con ONPG (4mg mL-1) en tampón Z utilizando el procedimiento descrito en la sección "Determinación de la actividad enzimática". En un primer ensayo, se determinó la temperatura que proporciona la actividad óptima de la enzima. Así, se pre-incubó la enzima a una concentración final de 113 ^g mL-1 en el tampón Z a cada una de las temperaturas de prueba y se midió la actividad en función del o-nitrofenol liberado (tal y como se ha detallado en secciones anteriores) . Los resultados se expresaron como porcentaje de actividad relativa (porcentaje de actividad enzimática respecto al máximo registrado) . A partir de los datos que se proporcionan en la FIG. 1, se concluyó que la temperatura óptima se encontraba entorno a los 80°C. A continuación, se llevó a cabo un estudio de termoestabilidad de la enzima, en un rango de temperaturas de 55-75°C durante 1-2 horas. Los resultados se muestran en FIG. 2. De estos datos se concluye que la enzima es extremadamente activa durante largos periodos de tiempo en condiciones de temperatura elevadas, entre 55 y 75°C. Esto es indicativo de la elevada estabilidad de la enzima de la invención. Efecto del pH en la actividad enzimática Para estimar el efecto del pH en la actividad enzimática, se preincubaron 113 ^g mL-1 de la enzima a la temperatura óptima (80°C) en tampón Britton-Robinson 20 mM (Britton and Robinson, 1931, CXCVIII. Universal buffer solutions and the dissociation constant of veronal. J. Chem. Soc., v. 0, páginas 1456-1462) con diferentes valores de pHs, dentro del rango entre 5.0-8.5 ajustados con una solución de NaOH 1M empleando un pHmetro. A continuación, se cuantificó la actividad relativa frente a ONPG (4mg mL-1) . Los resultados se expresan como porcentaje de actividad relativa (porcentaje de actividad respecto a la máxima actividad registrada) y se recogen en la FIG. 3. Tal y como se puede observar, el óptimo de pH para la enzima de la invención se encontró entre 6.5-7.5. Estudio de producción y caracterización a temperaturas elevadas (70°C) Las concentraciones de GOS, glucosa, galactosa y lactosa se determinaron mediante HPLC (HPLC Waters Breeze I) , utilizando una columna Waters Sugar-Pak eluida a 90 °C con EDTA disódico 0.1 M en agua Milli-Q a un flujo de 0.5 mL min-1, y un detector de índice de refracción: 2414 (Waters) . Para llevar a cabo las reacciones se mezclaron 0.034 mg de proteína pura en tampón fosfato 0.1 M (pH 6.8) , suplementado con un 40% de lactosa. Las muestras (500 L) se incubaron a 70°C y 650 rpm. A las 0, 0.5, 1, 2, 4, 6 y 24 h se paró la reacción por calentamiento a 99 °C para inactivar la enzima. Todas las muestras se conservaron a -20 °C para su posterior análisis. Los carbohidratos se cuantificaron mediante calibración externa empleando unas soluciones estándar de galactosa, glucosa, lactosa, rafinosa y estaquiosa. La producción total de GOS se estimó expresando la concentración final como porcentaje de la concentración inicial de lactosa (en % p/v) . Se detectó un nivel de producción de GOS máximo del 48% utilizando 0.034 mg, con una concentración inicial de lactosa de 400 mg/mL. y tras cuatro horas de reacción. Los perfiles cromatográficos obtenidos mediante HPLC indican que los GOS predominantes producidos por BWg1 son también trisacáridos seguidos de tetrasacáridos que son los que muestran los mejores efectos. Estudio de producción y caracterización a bajas temperaturas (8°C) Los inventores llevaron a cabo un estudio comparativo con enzimas comerciales para comprobar la diferencia de eficacia en la obtención de un producto rico en GOS. En estos experimentos se comparó la capacidad de hidrólisis y de producción de GOS de la p-galactosidasa BWßg1 de la invención con las p-galactosidasas comerciales Biolactasa NL Super (Biocon) y Maxilact LGi 5000 (DSM) . Para poder comparar se utilizaron las mismas unidades enzimáticas (UE) en las tres enzimas (34, 32 micromoles/min en 50 microlitros de agua bidestilada) por lo que se tuvo que diluir cien veces los preparados comerciales. Para el experimento, se pusieron 50 microlitros de cada una de las enzimas diluidas (todas ellas con las mismas UE totales, como se ha indicado previamente) en presencia de 450 microlitros de leche fresca semidesnatada de la casa Milbona (de LIDL) . Se incubaron a 8°C durante 24 horas y se sacó una muestra a las 16 horas y a las 24 horas. Tras las 24 horas se llevó a cabo la etapa de pasteurización que consistió en someter la muestra a 79°C durante 17 segundos. Se tomó una muestra inmediatamente después de la pasteurización (HTST 0 h) y tras dejar transcurrir un periodo de 24 horas en nevera a 4°C (HTST 24 h) . Posteriormente, las muestras se guardaron congeladas, hasta que se pasaron por filtros de corte 10K (para eliminar la enzima, así como las proteínas y grasa de la leche) centrifugando a 13000 durante 10 minutos. El eluido se diluyó diez veces y se pasó por filtros de 0, 22 micras a través de una jeringuilla. Se cargaron 15 microlitros en el HPLC para determinar la concentración de GOS, siguiendo el protocolo descrito en la sección anterior. Todas las muestras se realizaron por triplicado. Como control, se hizo un triplicado de la leche fresca semidesnatada con lactosa (450 microlitros más 50 microlitros de agua) y de la leche fresca semidesnatada sin lactosa (450 microlitros más 50 microlitros de agua) , las dos de la marca Milbona de LIDL. Se encontró que la enzima beta-galactosidasa de la invención era capaz de producir cantidades significativas y superiores de GOS independientemente de la temperatura, ya fuera de 79°C (temperatura de pasteurización) o de 8°C (temperatura de almacenamiento) , tal y como se muestra en la Fig. 4. Por otro lado, los inventores encontraron que la enzima, una vez finalizado en proceso de pasteurización y tras un periodo de reposo de 24 horas, continuaba produciendo de anera significativa GOS. Finalmente, se encontró que la enzima BWßg1 de la invención, aun siendo una enzima termoestable, tiene actividad a la temperatura baja de ensayo, 8°C, y en las condiciones experimentales probadas, presenta una reducción de lactosa del 63% tras 24 horas de incubación a 8°C y posterior pasteurización, frente al 52, 6% de la enzima comercial de la marca Biocon y el 38, 5% de la enzima comercial Maxilact, lo que supone una diferencia significativa de hidrólisis de lactosa de la enzima BWßg1 con respecto a las dos preparaciones comerciales. Así, se encontró que la enzima de la invención era capaz de producir prácticamente la misma cantidad de GOS incubando el sustrato con la enzima en frío que durante el proceso de pasteurización. Esto es significativo del comportamiento dual y la extraordinaria estabilidad y versatilidad en semejante rango de temperaturas. LISTA DE CITAS Altschul, S. F.et al., "Basic local alignment search tool", J. Mol. Biol., 1990, v. 215, páginas 403410. Britton, H. T. S., et al., "CXCVIII. Universal buffer solutions and the dissociation constant of veronal", J. Chem. Soc., 1931, v. 0, 1456-1462. de Castro, E., et al., "ScanProsite: Detection of PROSITE signature matches and ProRule-associated functional and structural residues in proteins", Nucleic Acids Res., 2006, v. 34, páginas W362-W365. Sievers, F. et al. "Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega", Mol. Syst. Biol., v. 7, 539.
+ ES-2909902_A1 Beta-galactosidasa y usos de la misma La presente invención está relacionada con los campos de la enzimología y la industria agroalimentaria. En particular, la presente invención se refiere a una nueva enzima pgalactosidasa y a su uso en la hidrólisis de lactosa, así como en la producción de galactooligosacáridos (GOS) a partir de lactosa. Las propiedades únicas de la enzima de la invención la hace especialmente útil para llevar a cabo la producción de GOS tanto en condiciones de pasteurización como a baja temperatura, lo cual supone una ventaja industrial importante respecto a otras enzimas. ESTADO DE LA TÉCNICA La p-galactosidasa (EC 3.2.1.23) , también llamada lactasa, tiene como función primaria la hidrólisis de la lactosa en D-galactosa y D-glucosa. Por ello, la aplicación fundamental de las p-galactosidasas se circunscribe al ámbito de los productos y subproductos lácteos. Además, esta enzima posee actividad transgalactosilasa y se utiliza para la síntesis de galactosil-oligosacáridos, compuestos con un interés creciente en el área agroalimentaria y farmacéutica. Como alternativa no enzimática a la hidrólisis con p-galactosidasas se puede utilizar la hidrólisis química, pero produce efectos no deseables (p. ej.: pérdida de nutrientes, defectos organolépticos, etc.) Las p-galactosidasas se emplean en la industria agroalimentaria para reducir el contenido en lactosa de productos lácteos y derivados, lo que tiene un interés muy variado. Industrialmente, dos tipos de p-galactosidasas son de creciente importancia en los procesos: las termoestables y las resistentes al frío. El empleo de enzimas termoestables a altas temperaturas está relacionado a la disminución de la viscosidad del sustrato y a la reducción de la posibilidad de contaminación microbiana. Las enzimas activas en el frío posibilitan su aplicación en el tratamiento de la leche y de los productos lácteos bajo condiciones que permiten preservar el sabor y las características nutricionales de esos alimentos. La producción de derivados lácteos con niveles reducidos de lactosa se atribuye a tres principales ventajas: (a) la obtención de productos para los grupos de población con intolerancia a la lactosa; (b) formación de los galatooligosacáridos (GOS) , que favorecen el crecimiento de la microflora intestinal; y (c) mejora en las características tecnológicas de los productos lácteos. La hidrólisis de la lactosa con la p-galactosidasa tiene su mayor foco en el desarrollo de leche y derivados lácteos que estén exentos o con contenidos reducidos de ese azúcar, posibilitando su consumo por individuos intolerantes a la lactosa. Por otro lado, la alta concentración de la lactosa en productos lácteos no fermentados, como por ejemplo en helado y leche condensada, puede llevar a la cristalización excesiva de la lactosa, resultando en productos con textura arenosa o áspera. De esta forma, la hidrólisis mejora la capacidad de absorción y cremosidad, y estos productos se tornan más digeribles. Otra perspectiva de la utilización de esta enzima es la producción de galactooligosacáridos, carbohidratos considerados prebióticos y que presentan propiedades tecnológicas y nutricionales reconocidas. Entre las ventajas asociadas a la síntesis de estos carbohidratos a partir de la lactosa está la reducción en el contenido calórico del alimento, la reducción de la intolerancia a la lactosa y otros tres importantes efectos provenientes de la sinergia entre los GOS y los probióticos, es decir, en la modulación del sistema inmune, el tránsito intestinal y el estímulo a la asimilación de nutrientes. A pesar de los esfuerzos realizados hasta la fecha, existe todavía la necesidad de enzimas p-galactosidasas termoestables con una actividad mejorada. EXPLICACIÓN DE LA INVENCIÓN Los presentes inventores han encontrado una nueva enzima beta-galactosidasa (BWpgl) que muestra ser estable y eficiente en la producción de GOS a temperaturas elevadas, compatibles con los tratamientos de esterilización de productos lácteos, disminuyendo significativamente el riesgo de contaminación por crecimiento microbiano adventicio. Los datos proporcionados más abajo también muestran que la enzima de la invención tiene una alta afinidad por su sustrato natural, la lactosa. Y, por otro lado, que la enzima de la invención es altamente eficiente en la producción de GOS, produciendo cantidades significativas de galactooligosacáridos en un corto periodo de tiempo. Además, es versátil en cuanto a la naturaleza del sustrato, ya que partiendo de lactosa o leche se alcanzan rendimientos altos. Por lo que la enzima de la invención ejerce un doble papel: hidroliza la lactosa y, a la vez, sintetiza GOS. Ambas actividades, además, a bajas y altas temperaturas. La buena capacidad catalítica de la beta-galactosidasa de la invención, por lo tanto, tiene un impacto sorprendente en las propiedades finales del producto ya que la enzima es capaz de degradar la lactosa, que puede tener un efecto perjudicial, e incorporar GOS, con un efecto beneficioso, al producto. Por lo tanto, la enzima de la invención permite obtener productos con propiedades beneficiosas para la salud. En relación con lo anterior, es remarcable que esa doble función es exhibida por la enzima en las mismas condiciones de temperatura y pH, es decir que en una sola etapa de incubación de la enzima con el sustrato, se consigue la reducción en el contenido de lactosa y la producción de GOS. Sorprendentemente, las condiciones de temperatura y pH óptimas hacen que la enzima de la invención se pueda usar en un proceso de pasteurización. Tal y como se muestra más abajo, los investigadores llevaron a cabo la pasteurización de un producto lácteo en presencia de la enzima de la invención y de dos enzimas comerciales: únicamente en el caso de la enzima de la invención, se consiguió simultáneamente una producción notable de GOS y una reducción significativa de la lactosa. Lo anterior supone una mejora sustancial en el sector agroalimentario, en particular de productos lácteos, ya que la enzima de la invención permite llevar a cabo en una única etapa a condiciones de temperatura, tiempo y pH: la hidrólisis de lactosa, la producción de GOS y la destrucción de microorganismos. Sorprendentemente, los inventores han encontrado, además, que esta enzima es altamente activa a temperaturas bajas, entre 3 y 10°C. Ventajosamente, trabajando a estas temperaturas se previene el crecimiento de microorganismos. Es la primera vez que se reporta una enzima beta-galactosidasa con semejante perfil de actividad en condiciones de temperatura tan diferentes, haciendo de esta enzima una herramienta altamente versátil. La versatilidad, así como la alta eficacia en síntesis de GOS e hidrólisis de lactosa hacen de la enzima de la invención una herramienta muy atractiva en el sector agroalimentario, en particular de los productos lácteos. Así, en un primer aspecto la presente invención proporciona una enzima que tiene actividad p-galactosidasa, dicha enzima comprendiendo una secuencia seleccionada de entre (a) una secuencia de aminoácidos con una identidad de secuencia de al menos un 85% con la secuencia SEC ID NO: 1; y (b) una secuencia de aminoácidos codificada por una secuencia de nucleótidos que tiene una identidad de secuencia de al menos un 85% con la secuencia SEC ID NO: 2. En una realización, la enzima tiene una identidad de secuencia aminoacídica de al menos un 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 o es 100% con la secuencia SEC ID NO: 1. En una realización, la enzima tiene una identidad de secuencia del 100% con la secuencia SEC ID NO: 1. En una realización, la enzima tiene una identidad de secuencia nucleotídica de al menos un 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 o es 100% con la secuencia SEC ID NO: 2. En una realización, la enzima tiene una identidad de secuencia del 100% con la secuencia SEC ID NO: 2. En la presente invención, el término "identidad" se refiere al porcentaje de residuos que son idénticos en las dos secuencias cuando las secuencias se alinean óptimamente. Si, en el alineamiento óptimo, una posición en una primera secuencia está ocupada por el mismo residuo que la posición correspondiente en la segunda secuencia, las secuencias presentan identidad con respecto a esa posición. El nivel de identidad entre dos secuencias (o "porcentaje de identidad de secuencia") se mide como una relación del número de posiciones idénticas compartidas por las secuencias con respecto al tamaño e las secuencias (es decir, porcentaje de identidad de secuencia = (número de posiciones idénticas / número total de posiciones) x 100) . Se conocen varios algoritmos matemáticos para obtener rápidamente el alineamiento óptimo y calcular la identidad entre dos o más secuencias y se incorporan en varios programas de software disponibles. Ejemplos de dichos programas incluyen los programas MATCH-BOX, MULTAIN, GCG, FASTA y ROBUST, entre otros, para el análisis de secuencias. Los programas de análisis de software preferidos incluyen los programas ALIGN, CLUSTAL W y BLAST (por ejemplo, BLAST 2.1, BL2SEQ y versiones posteriores de los mismos) . Para el análisis de secuencias de aminoácidos, se usan matrices de pesos, tales como las matrices BLOSUM (por ejemplo, las matrices BLOSUM45, BLOSUM50, BLOSUM62 y BLOSUM80) , matrices Gonnet o matrices PAM (por ejemplo, las matrices PAM30, PAM70, PAM120, PAM160, PAM250 y PAM350) , con el fin de determinar la identidad. Los programas BLAST proporcionan el análisis de al menos dos secuencias de aminoácidos, ya sea alineando una secuencia seleccionada contra múltiples secuencias en una base de datos (por ejemplo, GenSeq) , o, con BL2SEQ, entre dos secuencias seleccionadas. Los programas BLAST se modifican preferentemente con programas de filtrado de baja complejidad tales como los programas DUST o SEG, que preferentemente se integran en las operaciones del programa BLAST. Si se usan costes por existencia de huecos (o puntuaciones por hueco) , el coste por existencia de huecos se establece preferentemente entre aproximadamente -5 y -15. Se pueden usar parámetros por hueco similares con otros programas según convenga. Los programas BLAST y los principios que los subyacen se describen adicionalmente en, por ejemplo, Altschul et al., "Basic local alignment search tool", 1990, J. Mol. Biol, v. 215, páginas 403-410. Para el análisis de múltiples secuencias, se puede usar el programa CLUSTAL W. El programa CLUSTAL W se ejecuta deseablemente usando parámetros "dinámicos" (frente a "rápidos") . Las secuencias de aminoácidos se evalúan usando un conjunto variable de matrices BLOSUM dependiendo del nivel de identidad entre las secuencias. El programa CLUSTAL W y los principios de operación subyacentes se describen adicionalmente en, por ejemplo, Higgins et al., "CLUSTAL V: improved software for multiple sequence alignment", 1992, CABIOS, 8 (2) , páginas 189-191. En una realización del primer aspecto de la invención, la enzima tiene actividad en un rango de pH entre 6 y 9, y en un rango de temperatura entre 3 y 10°C y/o entre 60 y 89°C. En otra realización del primer aspecto de la invención, la enzima tiene actividad a un pH entre 6.5 y 8 y un rango de temperatura entre 4 y 9°C y/o entre 75 y 85°C. Para los fines de la presente invención, cualquier intervalo dado incluye los valores de los extremos inferior y superior del intervalo. En un segundo aspecto, la presente invención proporciona una secuencia nucleotídica recombinante que comprende una secuencia nucleotídica que codifica la enzima de la invención, unida operativamente a un promotor de expresión. En una realización, la secuencia nucleotídica recombinante comprende una secuencia nucleotídica que codifica una secuencia que tiene una identidad de al menos un 85% con la secuencia SEC ID NO: 2. En otra realización del segundo aspecto de la invención la secuencia nucleotídica codifica para una secuencia que tiene una identidad de al menos un 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 o es 100% con la secuencia SEC ID NO: 2. En otra realización del segundo aspecto de la invención, la secuencia nucleotídica que codifica la enzima se corresponde con la secuencia SEQ ID NO: 2. Ejemplos ilustrativos y no limitativos de promotores de expresión son los promotores de: LTR, SV40, lac o trp de E. coli, PL del fago lambda y otros conocidos por controlar la expresión de genes en células eucariotas, procariotas o virus. En un tercer aspecto la presente invención proporciona una construcción de expresión que comprende la secuencia nucleotídica recombinante del segundo aspecto de la invención. Las construcciones comprenden un vector, tal como un plásmido, en el que se inserta la secuencia de la enzima en una orientación directa o inversa. En una realización del tercer aspecto, la construcción génica es un vector de expresión. Ejemplos ilustrativos y no limitativos de vectores comerciales son: pQE70, pQE60, pQE-9 (Qiagen) , pD10, psiX174, pBluescript II KS; pNH8A, pNH16a, pNH18A, pNH46A (Stratagene) ; ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia) ; Eukar y otic: pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia) . Los vectores incluyen secuencias de ADN cromosómicas, no cromosómicas y sintéticas, por ejemplo, derivados de SV40; plásmidos bacterianos; ADN de fago; baculovirus; plásmidos de levadura; vectores derivados de combinaciones de plásmidos y ADN de fagos, ADN viral como vaccinia, adenovirus, virus de la viruela aviar y pseudorrabia. Sin embargo, puede usarse cualquier otro vector siempre que sea replicable y viable en el hospedador. El vector de expresión también proporciona un sitio de unión al ribosoma para el inicio de la traducción y un terminador de la transcripción. El vector también puede incluir secuencias apropiadas para amplificar la expresión. Además, los vectores de expresión pueden contener uno o más genes marcadores seleccionables para proporcionar un rasgo fenotípico para la selección de células hospedadoras transformadas tales como dihidrofolato reductasa o resistencia a neomicina para cultivo de células eucarióticas, o tal como resistencia a tetraciclina o ampicilina en E. coli. La inserción del gen de la presente invención en un vector, la inserción del gen marcador de selección (si es necesario) y la inserción de un promotor (si es necesario) , y similares, pueden llevarse a cabo mediante una tecnología de ADN de recombinación estándar. En un cuarto aspecto la presente invención proporciona una célula hospedadora recombinante transformada con el ácido nucleico recombinante del segundo aspecto de la invención o la construcción del tercer aspecto de la invención. Ejemplos ilustrativos y no limitativos de células hospedadoras adecuadas son: células bacterianas, como Escheríchia coli, Streptomyces, Bacillus subtilis; fúngicas como la levadura; células de insecto como la Dmsophila S2 y Spodoptera Sf9; de animal tal como CHO, COS o de melanoma de Bowes; adenovirus; células vegetales, etc. la selección de un hospedador adecuado forma parte del conocimiento del experto en la materia. La célula hospedadora transformada se puede obtener por transfección o transformación, usando el vector de la presente invención mencionado anteriormente. La transfección y transformación se pueden llevar a cabo, por ejemplo, mediante un método de coprecipitación de fosfato cálcico, electroporación, lipofección, microinyección, un método de Hanahan, un método de acetato de litio, método de protoplasto - polietilenglicol, y similares. Otro aspecto de la invención es proporcionar un método para producir una pgalactosidasa. En una realización del método de producción de la invención, la pgalactosidasa se produce utilizando el transformante mencionado anteriormente. En el método de producción de esta realización, el transformante se cultiva en condiciones tales que se produzca la enzima codificada. Los métodos de cultivo y las condiciones de cultivo no están particularmente limitadas siempre que se pueda producir la proteína p-galactosidasa deseada. Es decir, los métodos y las condiciones de cultivo adecuadas para cultivar los microorganismos que se van a utilizar pueden ajustarse de forma apropiada a las condiciones en las que se produce la p-galactosidasa. Se puede emplear cultivo líquido o cultivo sólido como método de cultivo, en particular cultivo líquido. Como medio, se puede utilizar cualquier medio en el que puedan crecer los transformantes que se van a utilizar. Por ejemplo, un medio suplementado con una fuente de carbono como glucosa, sacarosa, gentiobiosa, almidón soluble, glicerina, dextrina, melaza y ácido orgánico; y además, una fuente de nitrógeno tal como sulfato de amonio, carbonato de amonio, fosfato de amonio, acetato de amonio o peptona, extracto de levadura, licor de maceración de maíz, hidrolizado de caseína, salvado y extracto de carne; y además, se puede usar una sal inorgánica tal como sal de potasio, sal de magnesio, sal de sodio, sal de fosfato, sal de manganeso, sal de hierro y sal de zinc, y similares. Con el fin de promover el crecimiento de los transformantes que se van a usar, se puede añadir al medio vitaminas, aminoácidos y similares. El medio se cultiva en condiciones aeróbicas de manera que el pH del medio se ajuste, por ejemplo, a aproximadamente 3 a 10 (preferiblemente aproximadamente 7 a 8) , y la temperatura de cultivo es generalmente aproximadamente 10 ° C a 50 ° C (preferiblemente aproximadamente 20 ° C a 37 ° C) durante 1 a 7 días (preferiblemente 3 a 4 días) . Un ejemplo del método de cultivo puede incluir un método de cultivo por agitación y un método de cultivo aeróbico sumergido. Una vez se transforman las células con la onstrucción génica, estas se cultivan hasta alcanzar una densidad deseada y se induce, mediante métodos rutinarios, la activación del promotor de expresión. Las células transformadas se pueden recoger por centrifugación, romper por medios químicos o físicos, y el crudo resultante someterse a purificación. La enzima se puede recuperar y purificar de los medios de cultivo de células recombinantes mediante métodos que incluyen la precipitación por sulfato de amonio o etanol, la separación por cromatografía y la ultrafiltración. Se pueden incorporar también etapas de plegamiento para completar la configuración de la proteína madura. Finalmente, la purificación se puede llevar a cabo por cromatografía líquida de alta resolución (HPLC) . La p-galactosidasa de la presente invención se proporciona en forma de, por ejemplo, una preparación enzimática. La preparación enzimática puede contener, además de un ingrediente activo (p-galactosidasa de la presente invención) , excipiente, agentes tampón, agentes de suspensión, estabilizador, conservantes, antisépticos, solución salina fisiológica y similares. Los ejemplos del excipiente pueden incluir lactosa, sorbitol, D-manitol, sacarosa y similares. Los ejemplos del agente tampón pueden incluir fosfato, citrato, acetato y similares. Los ejemplos del estabilizador pueden incluir propilenglicol y ácido ascórbico y similares. Los ejemplos del conservante pueden incluir fenol, cloruro de benzalconio, alcohol bencílico, clorobutanol, metil parabeno y similares. Alternativamente, la enzima se puede inmovilizar sobre un material en fase sólida adecuado tal como un material de intercambio iónico, tal como DEAE-celulosa o material similar, para proporcionar productos de composición enzimática inmovilizada. Alternativamente, la enzima, opcionalmente en combinación con excipiente, agentes tampón, agentes de suspensión, estabilizador, conservantes, antisépticos, solución salina fisiológica y similares, se puede congelar o liofilizar. Ventajosamente, gracias al perfil de termoestabilidad mostrado por la enzima de la invención, el material resultante puede almacenarse o transportarse al laboratorio o entorno en el que se vaya a llevar a cabo posteriormente la reacción. El material liofilizado proporciona una forma más conveniente de almacenamiento y transporte, ya que no se requiere refrigeración. En un quinto aspecto, la presente invención proporciona un producto lácteo que comprende la enzima según se ha definido en el primer aspecto, la secuencia nucleotídica recombinante según el segundo aspecto, la construcción de expresión según el tercer aspecto o la célula hospedadora recombinante según el cuarto aspecto. En una realización, el producto lácteo comprende la enzima inactivada. Esta realización se corresponderá al producto final, una vez llevado a cabo el proceso de hidrólisis de lactosa/producción de GOS y se ha llevado a cabo la inactivación de la enzima mediante cualquiera de los protocolos rutinarios. En el contexto de la presente invención, el término "enzima inactivada" significa que la enzima se ha desnaturalizado, modificado o degradado y ha perdido su actividad betagalactosidasa. De la caracterización que se incorpora más abajo, los GOS producidos por la enzima de la invención, de 3 y 4 unidades, se han reportado en el estado de la técnica por ejercer un papel beneficioso en la salud. Por lo tanto, la enzima, secuencia recombinante, construcción de expresión o célula hospedadora descrita anteriormente puede usarse para producir una mezcla de galactooligosacáridos que puede formar parte de un producto para mejorar la salud intestinal. Dicho producto puede seleccionarse del grupo que consiste en productos lácteos (por ejemplo leche líquida, leche en polvo seca tal como la leche entera en polvo, leche desnatada en polvo, leche desnatada enriquecida en grasa en polvo, suero de leche en polvo, leches infantiles, leche maternizada, helados, yogur, queso, productos de leche fermentada) , bebidas tales como el zumo de fruta, los alimentos infantiles, cereales, pan, galletas, dulces, pasteles, suplementos alimenticios, suplementos dietéticos, alimentos para animales, alimentos para aves o por supuesto cualquier otro alimento o bebida. La presencia de galacto-oligosacáridos en dichos productos tiene la ventaja de incrementar el crecimiento de las Bifidobacterium promotoras de la salud en el producto o en la flora intestinal del consumidor después de la ingesta del producto o en ambos. En un sexto aspecto, la invención proporciona el uso de la enzima, de la secuencia nucleotídica recombinante, de la construcción de expresión o de la célula hospedadora recombinante de la invención, para la producción de galactooligosacáridos a partir de lactosa. En otro aspecto, la invención proporciona el uso de la enzima, de la secuencia nucleotídica recombinante, de la construcción de expresión o de la célula hospedadora recombinante de la invención, para incrementar la cantidad de GOS en un producto a base de lactosa. En un séptimo aspecto, la invención proporciona un procedimiento de producción de galactooligosacáridos que comprende la etapa de incubación de la enzima o célula hospedadora transformada según se definen más arriba con un producto a base de lactosa a un pH entre 6.5 y 8.0. En una realización, esta etapa de incubación se lleva a cabo a una temperatura comprendida entre 55 y 89°C o entre 65 y 85°C o entre 70 y 75°C, y a un pH entre 6.5 y 8. El tiempo de la etapa de incubación será el necesario para alcanzar la cantidad de GOS deseada y dependerá, entre otros factores, de la naturaleza del sustrato. El experto en la materia puede parar la incubación en cualquier momento inactivando la enzima, por ejemplo subiendo la temperatura por encima de 90°C, por ejemplo entre 90-100°C.En otra realización, previamente y/o posteriormente a la etapa de incubación a alta temperatura, el procedimiento comprende el enfriamiento del medio de reacción (que incluye el producto a base de lactosa y la enzima) a una temperatura entre 3 y 10°C, en particular entre 5 y 9°C, en particular 8°C durante un periodo de tiempo de entre 10 y 48 horas, particularmente entre 15 y 30 horas, a un pH entre 6.5 y 8. Alternativamente, en otra realización, la etapa de incubación se lleva a cabo a una temperatura comprendida entre 3 y 10°C, entre 5 y 9°C, o a 8°C. En otro aspecto, la invención proporciona un procedimiento para aumentar el contenido en galactooligosacáridos en un producto lácteo, que comprende la etapa de incubación de la enzima o célula hospedadora transformada según se definen más arriba con un producto a base de lactosa a un pH entre 6.5 y 8.0. En una realización, la incubación se lleva a cabo a una temperatura comprendida entre 55 y 89°C o entre 65 y 85°C o entre 70 y 75°C, a un pH entre 6.5 y 8. El tiempo de la etapa de incubación será el necesario para alcanzar la cantidad de GOS deseada y dependerá, entre otros factores, de la naturaleza del sustrato. El experto en la materia puede parar la incubación en cualquier momento inactivando la enzima, por ejemplo subiendo la temperatura por encima de 90°C, por ejemplo entre 90-100°C. En otra realización, previamente y/o posteriormente a la etapa de incubación a alta temperatura, el procedimiento comprende el enfriamiento del medio de reacción (que incluye el producto a base de lactosa y la enzima) a una temperatura entre 3 y 10°C, en particular entre 5 y 9°C, en particular 8°C, a un pH entre 6.5 y 8, durante un periodo de tiempo de entre 10 y 48 horas, particularmente entre 15 30 horas. Alternativamente, en otra realización, la etapa de incubación se lleva a cabo a una temperatura comprendida entre 3 y 10°C, entre 5 y 9°C, o a 8°C. En la presente invención, "producto a base de lactosa" tiene el mismo significado que "sustrato que contiene lactosa" y "producto lácteo" y se refiere a cualquier producto, natural o sintético, que incorpora en su composición lactosa o, alternativamente, consiste en lactosa. El producto a base de lactosa se puede seleccionar de entre lactosa comercial, leche entera, leche semidesnatada, leche desnatada, suero de leche, leche desnatada enriquecida en grasa y suero de leche filtrado. Estos productos lácteos pueden obtenerse de vacas, búfalas, ovejas, camellas, llamas o cabras. La leche desnatada enriquecida en grasa se define como la leche entera que ha sido desnatada para eliminar la grasa de la leche, la cual se reemplaza posteriormente añadiendo aceite o grasa vegetal. En un octavo aspecto, la presente invención proporciona el uso de la enzima, de la secuencia nucleotídica recombinante, de la construcción de expresión o de la célula hospedadora recombinante de la invención, según se han definido más arriba, en la hidrólisis de lactosa. En otro aspecto, la presente invención proporciona el uso de la enzima, de la secuencia nucleotídica recombinante, de la construcción de expresión o de la célula hospedadora recombinante de la invención, según se han definido más arriba, para reducir el contenido de lactosa en un producto a base de lactosa. En un noveno aspecto, la presente invención proporciona un procedimiento de hidrólisis de lactosa que comprende la etapa de incubación de la enzima o de la célula hospedadora recombinante según se ha definido más arriba, con un producto a base de lactosa, a un pH entre 6.5 y 8.0. En una realización, la incubación se lleva a cabo a una temperatura comprendida entre 55 y 89°C o entre 65 y 85 o entre 70 y 75°C, a un pH entre 6.5 y 8. El tiempo de la etapa de incubación será el necesario para alcanzar el nivel de lactosa deseado y dependerá, entre otros factores, de la naturaleza del sustrato. El experto en la materia puede parar la incubación en cualquier momento inactivando la enzima, por ejemplo subiendo la temperatura por encima de 90°C, por ejemplo entre 90-100°C. Alternativamente, en otra realización, la etapa de incubación se lleva a cabo a una temperatura comprendida entre 3 y 10°C, entre 5 y 9°C, o a 8°C, a pH entre 6.5 y 8. En otra realización, previamente y/o posteriormente a la etapa de incubación, el rocedimiento comprende el enfriamiento del medio de reacción (que incluye el producto a base de lactosa y la enzima) a una temperatura entre 3 y 10°C, en particular entre 5 y 9°C, en particular 8°C, a un pH entre 6.5 y 8, durante un periodo de tiempo de entre 10 y 48 horas, particularmente entre 15 y 30 horas. En otro aspecto, la presente invención proporciona un procedimiento de reducción del contenido de lactosa en un producto lácteo, que comprende la etapa de incubación de la enzima o de la célula hospedadora recombinante según se ha definido más arriba, con un producto a base de lactosa, a un pH entre 6.5 y 8.0. En una realización, la incubación se lleva a cabo a una temperatura comprendida entre 55 y 89°C o entre 65 y 85 o entre 70 y 75°C, a un pH entre 6.5 y 8. El tiempo de la etapa de incubación será el necesario para alcanzar la cantidad de GOS deseada y dependerá, entre otros factores, de la naturaleza del sustrato. El experto en la materia puede parar la incubación en cualquier momento inactivando la enzima, por ejemplo subiendo la temperatura por encima de 90°C, por ejemplo entre 90-100°C.Alternativamente, en otra realización, la etapa de incubación se lleva a cabo a una temperatura comprendida entre 3 y 10°C, entre 5 y 9°C, o a 8°C, a un pH entre 6.5 y 8. En otra realización, previamente y/o posteriormente a la etapa de incubación, el procedimiento comprende el enfriamiento del medio de reacción (que incluye el producto a base de lactosa y la enzima) a una temperatura entre 3 y 10°C, en particular entre 5 y 9°C, en particular 8°C, durante un periodo de tiempo de entre 10 y 48 horas, particularmente entre 15 y 30 horas, a un pH entre 6.5 y 8. Generalmente los procedimientos y aparatos empleados para la hidrólisis de lactosa son similares a los usados comúnmente en procesos de hidrólisis enzimática equivalentes y una amplia gama de posibles sistemas y procedimientos serán evidentes para los expertos en la técnica. Por tanto, en una realización, en un modo de incubación continua, el sustrato que contiene lactosa en forma de solución se pasa a un reactor que contiene la enzima o la preparación de células enteras enzimáticamente activa, preferiblemente en forma inmovilizada. La composición de enzima inmovilizada o la preparación de células enteras inmovilizadas, y los productos de glucosa y galactosa se recuperan aguas abajo del reactor. En una realización de los procedimientos proporcionados por la presente invención, el sustrato a base de lactosa que se utiliza en la etapa de incubación es líquido. En otra realización de los procedimientos proporcionados por la presente invención, el sustrato a base de lactosa que se utiliza en la etapa de incubación es sólido. En esta realización, la enzima se puede incorporar en forma de preparación enzimática líquida o, alternativamente, añadirla en forma sólida, para, posteriormente, incorporar un medio acuoso a un pH entre 6.5 y 8.0. Además, en vista de la alta estabilidad térmica la enzima puede incorporarse directamente con productos lácteos UHT antes del tratamiento térmico y puede esterilizarse ventajosamente junto con la leche durante el tratamiento térmico. Así, en un décimo aspecto la presente invención proporciona un procedimiento de preparación de un producto lácteo esterilizado, en particular pasteurizado, que comprende pasteurizar el producto lácteo, tal como leche, en presencia de la enzima o la célula hospedadora recombinante según se han definido más arriba. En una realización del décimo aspecto, la etapa de pasteurización se lleva a cabo a una temperatura entre 55 y 90°C, durante un periodo de tiempo entre 5 y 30 segundos. En otra realización del décimo aspecto, previamente a la etapa de pasteurización, el producto lácteo, en presencia de la enzima, se enfría a una temperatura entre 3 y 10°C, particularmente entre 4 y 9°C, particularmente entre 6 y 8.5°C. En otra realización del décimo aspecto, posteriormente a la etapa de pasteurización, el producto lácteo resultante se enfría a una temperatura entre 3 y 10°C, particularmente entre 3.5 y 5°C, particularmente a 4°C. En otra realización del décimo aspecto, se lleva a cabo una etapa de enfriamiento antes (entre 3-10°C) y después de la pasteurización (entre 4-9°C) . En otra realización del décimo aspecto, la (s) etapa (s) de enfriamiento se lleva (n) a cabo durante un periodo de tiempo de entre 10 y 48 horas, particularmente entre 15 y 30 horas. En una realización de los procedimientos de la invención, estos comprenden opcionalmente una o más de las etapas de inactivación y/o eliminación de la enzima, conversión del producto resultante a polvo y empaquetado en forma líquida o en polvo. Como se ha ido explicando con anterioridad y se demuestra más abajo, el producto resultante de la acción enzimática de la beta-galactosidasa de la invención presenta un bajo contenido en lactosa y está enriquecido en GOS. Por lo tanto, en undécimo aspecto, la presente invención proporciona un producto lácteo obtenible mediante cualquiera de los procedimientos proporcionados por la presente invención. A lo largo de la descripción y las reivindicaciones la palabra "comprende" y sus variantes no pretenden excluir otras características técnicas, aditivos, componentes o pasos. Además, la palabra "comprende" incluye el caso "consiste en". Para los expertos en la materia, otros objetos, ventajas y características de la invención se desprenderán en parte de la descripción y en parte de la práctica de la invención. Los siguientes ejemplos y dibujos se proporcionan a modo de ilustración, y no se pretende que sean limitativos de la presente invención. Los signos numéricos relativos a los dibujos y colocados entre paréntesis en una reivindicación, son solamente para intentar aumentar la comprensión de la reivindicación, y no deben ser interpretados como limitantes del alcance de la protección de la reivindicación. Además, la presente invención cubre todas las posibles combinaciones de realizaciones particulares y preferidas aquí indicadas. BREVE DESCRIPCIÓN DE LOS DIBUJOS FIG. 1 representa el efecto de la temperatura (T) expresada en grados centígrados en la actividad relativa (A) de la enzima, expresado en % (actividad relativa: % de actividad respecto al máximo de actividad registrada en el ensayo) . El eje Y representa la actividad, y el eje X la temperatura. FIG. 2 representa la actividad enzimática relativa (A) , expresada en %, en función de la temperatura: a 75 °C (a) , 65 °C (b) y 55 (°C) y a diferentes tiempos (t) expresados en horas. El eje "Y" representa la actividad relativa enzimática y el eje "Y" el tiempo. FIG. 3 representa el efecto del pH en la actividad relativa (A) de la enzima, expresada en %. El eje Y representa la actividad relativa, y el eje X el pH. FIG. 4 representa la producción de GOS por la enzima de la invención (barra negra) y los preparados comerciales Biocon (barra gris) y Maxilact (barra blanca) a las 16 y 24 oras de incubación a 8°C y tras la pasteurización a tiempo cero (HTST 0 h) y 24 horas después a 4°C (HTST 24 h) . Las estrellas indican si hay diferencias significativas aplicando una t-student del resultado obtenido con la enzima BWpgl con respecto a la p-galactosidasa de Biocon (estrella gris) o con la p-galactosidasa de Maxilact (estrella blanca) . EJEMPLOS 1. Clonaje, expresión y purificación de la B-galactosidasa Un clon de secuencia SEC ID NO: 2, seleccionado por búsqueda funcional en una metagenoteca en plásmido construida a partir de las aguas termales de As Burgas (Ourense) , se comprobó que era capaz de hidrolizar X-Gal (5-bromo-4-cloro-indolyl-B-D-galactopiranósido) ya que dio lugar a una coloración azulada en placas sólidas de medio Luria Bertani (LB) suplementadas con 100 ^g/ml de ampicilina y 0.04 % X-Gal en N, N-dimetilformamida. La secuencia de aminoácidos deducida para dicha enzima se corresponde con la secuencia SEQ ID NO: 1. La ORF de la B-galactosidasa (BWpgl) se amplificó directamente a partir del clon positivo con los cebadores MCA141 (5'CAATTCCCCTCTAGAATGACCCTGCGTGAGTTC3' (SEC ID No: 3) ) y MCA140 (5'AGTGGTGGTGGTGGTGGTGCACCCTCATACATAGCCTCAC3' (SEC ID NO: 4) ) . Para el ligamiento en el vector pET21a se utilizó el kit NEBuilder HiFi DNA assembly (New England Biolabs, "NEB") . La construcción se usó para transformar en células de E. coli T7 Express (C2566) (NEB) mediante choque térmico, siguiendo las instrucciones del fabricante y expresar la proteína, para lo cual se indujo con 0.4 mM IPTG durante 2 horas a 37°C. A continuación, se centrifugaron las células (5000 rpm 15 min 4°C) y se resuspendieron en tampón fosfato sódico 20mM pH 7.2 con 500 mM NaCl y un cocktail inhibidor de proteasas Complete Mini EDTA-Free Protease Inhibitor Cocktail (Roche) . La lisis celular se llevó a cabo mediante sonicación en hielo con un Vibra Cell sonicator (100W, 5min 2"ON/8"OFF) , (Sonics & Materials) . El extracto crudo resultante se calentó a 70°C durante 10 minutos para desnaturalizar las proteínas de E. coli. Posteriormente, el sobrenadante obtenido tras la centrifugación (14000 rpm 20 min) se hizo pasar a través de una columna de histidinas HisTrapTM HP column (GEHealthcare) iguiendo las instrucciones del fabricante y empleando un sistema de cromatografía ÁKTA (GEHealthcare) . Brevemente, la columna se equilibró con tampón fosfato sódico 20mM pH 7.2, 500 mM NaCl y 20 mM imidazol y la elución de la proteína se llevó a cabo con tampón fosfato sódico 20mM pH 7.2, 500 mM NaCl y 500 mM imidazol. Se seleccionaron aquellas fracciones correspondientes al pico de elución de la cromatografía, realizándose posteriormente un ensayo de actividad p-galactosidasa en cada una de ellas para comprobar la presencia de la enzima. Las fracciones seleccionadas se concentraron y dializaron empleando una columna Amicon Ultra-15 30, 000 MWCO (Millipore) . La concentración de proteína purificada se cuantificó siguiendo el protocolo del kit Bio-Rad Protein Assay (Bio-Rad) , utilizando seroalbúmina bovina como estándar. Las muestras de proteína en las diferentes etapas de la purificación se cargaron en un gel de acrilamida al 10% SDS-PAGE para la determinación de su peso molecular. El NZYcolour Protein Marker II (Nzytech) fue utilizado como marcador de pesos moleculares y la visualización de las proteínas se llevó a cabo mediante tinción con azul de Coomasie. De esta manera se acabó concluyendo que la enzima con actividad betagalactosidasa tenía un peso molecular de aproximadamente 75 kDa. Análisis de la secuencia aminoacídica de la proteína La secuencia aminoacídica deducida a partir de la secuencia de nucleótidos obtenida tras la secuenciación del clon positivo se comparó con otras secuencias conocidas utilizando una herramienta de búsqueda por alineamiento local proteína-proteína (BLAST) (Altschul et al., "Basic local alignment search tool", 1990, J. Mol. Biol, v. 215, páginas 403-410) . Los motivos conservados en las secuencias se buscaron empleando la herramienta ScanProsite (de Castro et al., 2006, "ScanProsite: Detection of PROSITE signature matches and ProRule-associated functional and structural residues in proteins". Nucleic Acids Res., v. 34) . Asimismo, se llevó a cabo un alineamiento múltiple de secuencias con Clustal Omega (Sievers et al., 2011, Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol., v. 7) y el mismo programa se utilizó para construir los árboles filogenéticos con otras pgalactosidasas de familias de Glicosil Hidrolasas (GHs) conocidas. Con los tests anteriores se concluyó que la secuencia de aminoácidos de BWbg1 consistía en 664 residuos aminoacídicos y que la enzima del estudio pertenece a la familia de las GH-35. Determinación de la actividad enzimática La cuantificación de la actividad enzimática se realizó empleando el sustrato ortonitrofenil-p-D-galactopiranósido (ONPG) . Las preparaciones de proteína purificada se diluyeron en 150 ^L de tampón Z (100 mM Na2 HPO4 , 40 mM NaH2 PO4 , 10 mM KCl, 1.6 mM MgSO4 pH 7) . Tras incubar durante 5 minutos a 80°C, se inició la reacción con la adición de 150 ^L de ONPG a una concentración de 4 mg mL-1. Para parar la reacción se adicionaron 100 ^L de Na2CO31 M a 100 ^L de la mezcla de reacción. El o-nitrofenol producido en la reacción se cuantificó mediante absorbancia UV a 420 nm. En los ensayos de pH, temperatura óptima y termoestabilidad se expresó la actividad enzimática como porcentaje de actividad relativa, es decir, porcentaje de actividad respecto al máximo de actividad registrada en el test. En los ensayos de cinética de ONPG e hidrólisis de lactosa la actividad p-galactosidasa se expresó en unidades enzimáticas (U) , definidas como la cantidad de enzima capaz de liberar un ^mol de producto (o-nitrophenol) por minuto (^molmin-1) en diferentes condiciones experimentales de temperatura y pH. En todos los casos las medidas se llevaron a cabo por triplicado. Cinética de ONPG e hidrólisis de lactosa. Determinación de la afinidad por lactosa La caracterización cinética de la enzima se basó en la determinación de la actividad pgalactosidasa de la proteína purificada a diferentes concentraciones de ONPG (0-10 mM) siguiendo el protocolo descrito en la sección anterior. Las medidas se realizaron por triplicado con 0.3 ^g mL-1 de enzima. Para estimar los valores de las constantes cinéticas se llevó a cabo un ajuste de regresión no lineal por mínimos cuadrados a partir de las gráficas de Michaelis Menten, con el software Prism 6.00 para Windows (GraphPad Software Inc.) . La cinética de la hidrólisis de lactosa se llevó a cabo determinando la glucosa liberada por la enzima a diferentes concentraciones de lactosa. Para ello, la proteína purificada se diluyó en tampón Z a una concentración de 104.5 ^g/mL. La velocidad inicial se determinó por triplicado utilizando 104.5 ^g mL-1 de enzima y una concentración de lactosa de 0, 10, 20 y 80 mM. Los tiempos de reacción fueron 6-20 min a 80 °C. Finalmente, se calentaron las muestras a 96 °C durante 5 min con el fin de parar la reacción. La actividad p-galactosidasa se expresa en unidades enzimáticas (U) , definidas como la cantidad de enzima capaz de liberar 1 ^mol de producto (D-glucosa) por minuto en las condiciones experimentales (^mol min -1) . La concentración de glucosa se cuantificó empleando el kit comercial D-Glucose GOD-POD (Nzytech) . Se utilizó un ajuste de regresión no linear por mínimos cuadrados para inferir los parámetros cinéticos a partir de las gráficas de Michaelis-Menten generadas (via Prism 6) . Tabla 2. Valores cinéticos de Km y Vmáx para la hidrólisis de lactosa y ONPG. ONPG Lactosa Vmax (U/mg) 42.75±3.94 25.86±1.03 Km (mM) 1.16±0.42 13.85±1.69 Vmax/Km 36.85 1.87 Efecto de la temperatura en la estabilidad y actividad enzimática El efecto de la temperatura se determinó cuantificando la actividad relativa (porcentaje de actividad respecto a la máxima actividad registrada) de la enzima a 55-90°C con ONPG (4mg mL-1) en tampón Z utilizando el procedimiento descrito en la sección "Determinación de la actividad enzimática". En un primer ensayo, se determinó la temperatura que proporciona la actividad óptima de la enzima. Así, se pre-incubó la enzima a una concentración final de 113 ^g mL-1 en el tampón Z a cada una de las temperaturas de prueba y se midió la actividad en función del o-nitrofenol liberado (tal y como se ha detallado en secciones anteriores) . Los resultados se expresaron como porcentaje de actividad relativa (porcentaje de actividad enzimática respecto al máximo registrado) . A partir de los datos que se proporcionan en la FIG. 1, se concluyó que la temperatura óptima se encontraba entorno a los 80°C. A continuación, se llevó a cabo un estudio de termoestabilidad de la enzima, en un rango de temperaturas de 55-75°C durante 1-2 horas. Los resultados se muestran en FIG. 2. De estos datos se concluye que la enzima es extremadamente activa durante largos periodos de tiempo en condiciones de temperatura elevadas, entre 55 y 75°C. Esto es indicativo de la elevada estabilidad de la enzima de la invención. Efecto del pH en la actividad enzimática Para estimar el efecto del pH en la actividad enzimática, se preincubaron 113 ^g mL-1 de la enzima a la temperatura óptima (80°C) en tampón Britton-Robinson 20 mM (Britton and Robinson, 1931, CXCVIII. Universal buffer solutions and the dissociation constant of veronal. J. Chem. Soc., v. 0, páginas 1456-1462) con diferentes valores de pHs, dentro del rango entre 5.0-8.5 ajustados con una solución de NaOH 1M empleando un pHmetro. A continuación, se cuantificó la actividad relativa frente a ONPG (4mg mL-1) . Los resultados se expresan como porcentaje de actividad relativa (porcentaje de actividad respecto a la máxima actividad registrada) y se recogen en la FIG. 3. Tal y como se puede observar, el óptimo de pH para la enzima de la invención se encontró entre 6.5-7.5. Estudio de producción y caracterización a temperaturas elevadas (70°C) Las concentraciones de GOS, glucosa, galactosa y lactosa se determinaron mediante HPLC (HPLC Waters Breeze I) , utilizando una columna Waters Sugar-Pak eluida a 90 °C con EDTA disódico 0.1 M en agua Milli-Q a un flujo de 0.5 mL min-1, y un detector de índice de refracción: 2414 (Waters) . Para llevar a cabo las reacciones se mezclaron 0.034 mg de proteína pura en tampón fosfato 0.1 M (pH 6.8) , suplementado con un 40% de lactosa. Las muestras (500 ^L) se incubaron a 70°C y 650 rpm. A las 0, 0.5, 1, 2, 4, 6 y 24 h se paró la reacción por calentamiento a 99 °C para inactivar la enzima. Todas las muestras se conservaron a -20 °C para su posterior análisis. Los carbohidratos se cuantificaron mediante calibración externa empleando unas soluciones estándar de galactosa, glucosa, lactosa, rafinosa y estaquiosa. La producción total de GOS se estimó expresando la concentración final como porcentaje de la concentración inicial de lactosa (en % p/v) . Se detectó un nivel de producción de GOS máximo del 48% utilizando 0.034 mg, con una concentración inicial de lactosa de 400 mg/mL. y tras cuatro horas de reacción. Los perfiles cromatográficos obtenidos mediante HPLC indican que los GOS predominantes producidos por BWpg1 son también trisacáridos seguidos de tetrasacáridos que son los que muestran los mejores efectos. Estudio de producción y caracterización a bajas temperaturas (8°C) Los inventores llevaron a cabo un estudio comparativo con enzimas comerciales para comprobar la diferencia de eficacia en la obtención de un producto rico en GOS. En estos experimentos se comparó la capacidad de hidrólisis y de producción de GOS de la p-galactosidasa BWpgl de la invención con las p-galactosidasas comerciales Biolactasa NL Super (Biocon) y Maxilact LGi 5000 (DSM) . Para poder comparar se utilizaron las mismas unidades enzimáticas (UE) en las tres enzimas (34, 32 micromoles/min en 50 microlitros de agua bidestilada) por lo que se tuvo que diluir cien veces los preparados comerciales. Para el experimento, se pusieron 50 microlitros de cada una de las enzimas diluidas (todas ellas con las mismas UE totales, como se ha indicado previamente) en presencia de 450 microlitros de leche fresca semidesnatada de la casa Milbona (de LIDL) . Se incubaron a 8°C durante 24 horas y se sacó una muestra a las 16 horas y a las 24 horas. Tras las 24 horas se llevó a cabo la etapa de pasteurización que consistió en someter la muestra a 79°C durante 17 segundos. Se tomó una muestra inmediatamente después de la pasteurización (HTST 0 h) y tras dejar transcurrir un periodo de 24 horas en nevera a 4°C (HTST 24 h) . Posteriormente, las muestras se guardaron congeladas, hasta que se pasaron por filtros de corte 10K (para eliminar la enzima, así como las proteínas y grasa de la leche) centrifugando a 13000 durante 10 minutos. El eluido se diluyó diez veces y se pasó por filtros de 0, 22 micras a través de una jeringuilla. Se cargaron 15 microlitros en el HPLC para determinar la concentración de GOS, siguiendo el protocolo descrito en la sección anterior. Todas las muestras se realizaron por triplicado. Como control, se hizo un triplicado de la leche fresca semidesnatada con lactosa (450 microlitros más 50 microlitros de agua) y de la leche fresca semidesnatada sin lactosa (450 microlitros más 50 microlitros de agua) , las dos de la marca Milbona de LIDL. Se encontró que la enzima beta-galactosidasa de la invención era capaz de producir cantidades significativas y superiores de GOS independientemente de la temperatura, ya fuera de 79°C (temperatura de pasteurización) o de 8°C (temperatura de almacenamiento) , tal y como se muestra en la Fig. 4. Por otro lado, los inventores encontraron que la enzima, una vez finalizado en proceso de pasteurización y tras un periodo de reposo de 24 horas, continuaba produciendo de anera significativa GOS. Finalmente, se encontró que la enzima BWpgl de la invención, aun siendo una enzima termoestable, tiene actividad a la temperatura baja de ensayo, 8°C, y en las condiciones experimentales probadas, presenta una reducción de lactosa del 63% tras 24 horas de incubación a 8°C y posterior pasteurización, frente al 52, 6% de la enzima comercial de la marca Biocon y el 38, 5% de la enzima comercial Maxilact, lo que supone una diferencia significativa de hidrólisis de lactosa de la enzima BWpgl con respecto a las dos preparaciones comerciales. Así, se encontró que la enzima de la invención era capaz de producir prácticamente la misma cantidad de GOS incubando el sustrato con la enzima en frío que durante el proceso de pasteurización. Esto es significativo del comportamiento dual y la extraordinaria estabilidad y versatilidad en semejante rango de temperaturas. LISTA DE CITAS Altschul, S. F.et al., "Basic local alignment search tool", J. Mol. Biol., 1990, v. 215, páginas 403410. Britton, H. T. S., et al., "CXCVIII. Universal buffer solutions and the dissociation constant of veronal", J. Chem. Soc., 1931, v. 0, 1456-1462. de Castro, E., et al., "ScanProsite: Detection of PROSITE signature matches and ProRule-associated functional and structural residues in proteins", Nucleic Acids Res., 2006, v. 34, páginas W362-W365. Sievers, F. et al. "Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega", Mol. Syst. Biol., v. 7, 539.

Publicaciones:
ES2909902 (10/05/2022) - A1 Solicitud de patente con informe sobre el estado de la técnica
ES2909902 (27/09/2023) - B2 Patente de invención con examen
Eventos:
En fecha 05/11/2020 se realizó Registro Instancia de Solicitud
En fecha 05/11/2020 se realizó Admisión a Trámite
En fecha 05/11/2020 se realizó 1001P_Comunicación Admisión a Trámite
En fecha 09/11/2020 se realizó 3406X_Solicitud Correcciones
En fecha 10/11/2020 se realizó 1551X_Notificación Correcciones Admitidas
En fecha 01/12/2020 se realizó Superado examen de oficio
En fecha 14/09/2021 se realizó Realizado IET
En fecha 16/09/2021 se realizó 1109P_Comunicación Traslado del IET
En fecha 10/05/2022 se realizó Publicación Solicitud
En fecha 10/05/2022 se realizó Publicación Folleto Solicitud con IET (A1)
En fecha 30/06/2022 se realizó PETEX_Petición de examen sustantivo
En fecha 25/08/2022 se realizó Validación petición y/o pago de examen sustantivo conforme
En fecha 11/10/2022 se realizó El solicitante ha contestado pero existen nuevas objeciones a la concesión de la solicitud
En fecha 11/10/2022 se realizó Elaboración de examen sustantivo
En fecha 19/10/2022 se realizó 6120P_Notificación de examen sustantivo
En fecha 21/10/2022 se realizó Publicación de examen sustantivo
En fecha 19/12/2022 se realizó 5127P_Subsanación a defectos en examen sustantivo
En fecha 13/09/2023 se realizó Designación de Comisión de Expertos
En fecha 13/09/2023 se realizó Finalización de Examen Sustantivo
En fecha 13/09/2023 se realizó 6121P_Comunicación finalización de examen sustantivo
En fecha 19/09/2023 se realizó Publicación finalización de examen sustantivo
En fecha 20/09/2023 se realizó Concesión con examen sustantivo
En fecha 20/09/2023 se realizó Entrega título
En fecha 20/09/2023 se realizó 6125P_Notificación de concesión con examen sustantivo
En fecha 27/09/2023 se realizó Publicación concesión Patente
En fecha 27/09/2023 se realizó Publicación Folleto Concesión
En fecha 27/03/2024 se realizó Plazo expirado presentación de oposiciones contra la concesión de la Patente
Pagos:
04/11/2020 - Pago Tasas IET
29/09/2023 - Pago 03 Anualidad
01/12/2023 - Pago 04 Anualidad

Fuente de la información

Parte de la información aquí publicada es pública puesto que ha sido obtenida de la Oficina de Propiedad Industrial de los diferentes países el 19/06/2024 y por lo tanto puede ser que la información no esté actualizada.

Parte de la información aquí mostrada ha sido calculada por nuestro sistema informático y puede no ser veraz.

Privacidad

Si considera que al información aquí publicada afecta a su privacidad y desea que eliminemos la información aquí publicada envíe un email a info@patentes-y-marcas.com o rellene el formulario que encontrará aquí.

Información sobre el registro de patente nacional por BETA-GALACTOSIDASA Y USOS DE LA MISMA con el número P202031111

El registro de patente nacional por BETA-GALACTOSIDASA Y USOS DE LA MISMA con el número P202031111 fue solicitada el 05/11/2020. Se trata de un registro en España por lo que este registro no ofrece protección en el resto de países. El registro BETA-GALACTOSIDASA Y USOS DE LA MISMA con el número P202031111 fue solicitada por UNIVERSIDADE DA CORUÑA mediante los servicios del agente Yahel Contreras Pérez. El registro [modality] por BETA-GALACTOSIDASA Y USOS DE LA MISMA con el número P202031111 está clasificado como C12N 9/38,C12N 15/56,A23C 9/12,C12P 19/14 según la clasificación internacional de patentes.

Otras invenciones solicitadas en la clasificación internacional de patentes C12N 9/38,C12N 15/56,A23C 9/12,C12P 19/14.

Es posible conocer invenciones similares al campo de la técnica se refiere. El registro de patente nacional por BETA-GALACTOSIDASA Y USOS DE LA MISMA con el número P202031111 está clasificado con la clasificación C12N 9/38,C12N 15/56,A23C 9/12,C12P 19/14 por lo que si se desea conocer más registros con la clasificación C12N 9/38,C12N 15/56,A23C 9/12,C12P 19/14 clicar aquí.

Otras invenciones solicitadas a través del representante YAHEL CONTRERAS PÉREZ

Es posible conocer todas las invenciones solicitadas a través del agente YAHEL CONTRERAS PÉREZ entre las que se encuentra el registro patente nacional por BETA-GALACTOSIDASA Y USOS DE LA MISMA con el número P202031111. Si se desean conocer más invenciones solicitadas a través del agente YAHEL CONTRERAS PÉREZ clicar aquí.

Patentes en España

Es posible conocer todas las invenciones publicadas en España entre las que se encuentra el registro patente nacional por BETA-GALACTOSIDASA Y USOS DE LA MISMA. Nuestro portal www.patentes-y-marcas.com ofrece acceso a las publicaciones de patentes en España. Conocer las patentes registradas en un país es importante para saber las posibilidades de fabricar, vender o explotar una invención en España.

Patentes registradas en la clase C

Es posible conocer todas las patentes registradas en la clase C (QUIMICA; METALURGIA) entre las que se encuentra la patente BETA-GALACTOSIDASA Y USOS DE LA MISMA con el número P202031111. Conocer las patentes registradas en una clase es importante para saber las posibilidades de registrar una patente en esa misma clase.

Patentes registradas en la clase C12

Es posible conocer todas las patentes registradas en la clase C12 (BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE; MICROBIOLOGIA; ENZIMOLOGIA; TECNICAS DE MUT) entre las que se encuentra la patente BETA-GALACTOSIDASA Y USOS DE LA MISMA con el número P202031111. Conocer las patentes registradas en una clase es importante para saber las posibilidades de registrar una patente en esa misma clase.

Patentes registradas en la clase C12N

Es posible conocer todas las patentes registradas en la clase C12N (MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS CONTIENEN;CULTURE OU CONSERVATION DE MICRO-ORGANISM) entre las que se encuentra la patente BETA-GALACTOSIDASA Y USOS DE LA MISMA con el número P202031111. Conocer las patentes registradas en una clase es importante para saber las posibilidades de registrar una patente en esa misma clase.

Patentes registradas en la clase A

Es posible conocer todas las patentes registradas en la clase A (NECESIDADES CORRIENTES DE LA VIDA) entre las que se encuentra la patente BETA-GALACTOSIDASA Y USOS DE LA MISMA con el número P202031111. Conocer las patentes registradas en una clase es importante para saber las posibilidades de registrar una patente en esa misma clase.

Patentes registradas en la clase A23

Es posible conocer todas las patentes registradas en la clase A23 (ALIMENTOS O PRODUCTOS ALIMENTICIOS; SU TRATAMIENTO, NO CUBIERTO POR OTRAS CLASES) entre las que se encuentra la patente BETA-GALACTOSIDASA Y USOS DE LA MISMA con el número P202031111. Conocer las patentes registradas en una clase es importante para saber las posibilidades de registrar una patente en esa misma clase.

Patentes registradas en la clase A23C

Es posible conocer todas las patentes registradas en la clase A23C () entre las que se encuentra la patente BETA-GALACTOSIDASA Y USOS DE LA MISMA con el número P202031111. Conocer las patentes registradas en una clase es importante para saber las posibilidades de registrar una patente en esa misma clase.

Patentes registradas en la clase C12P

Es posible conocer todas las patentes registradas en la clase C12P (PROCESOS DE FERMENTACION O PROCESOS QUE UTILIZAN ENZIMAS PARA LA SINTESIS DE UN COMPUESTO QUIMICO DA) entre las que se encuentra la patente BETA-GALACTOSIDASA Y USOS DE LA MISMA con el número P202031111. Conocer las patentes registradas en una clase es importante para saber las posibilidades de registrar una patente en esa misma clase.

¿Tienes alguna duda?
Escribe tu consulta y te responderemos rápida y gratuitamente.

Profesionales Recomendados

Facts